Commit 51c4dc5b authored by oshahmir's avatar oshahmir
Browse files

removing unnecessary folders

parent e9c24b8d
[Buildset]
BuildItems=@Variant(\x00\x00\x00\t\x00\x00\x00\x00\x01\x00\x00\x00\x0b\x00\x00\x00\x00\x01\x00\x00\x00\x1c\x00f\x00a\x00s\x00t\x00c\x00o\x00d\x00e\x00m\x00l\x00.\x00g\x00i\x00t)
[CMake]
Build Directory Count=1
Current Build Directory Index=0
ProjectRootRelative=./
[CMake][CMake Build Directory 0]
Build Directory Path=file:///home/omid/Projects/fastcodeml.git/build
Build Type=Debug
CMake Binary=file:///usr/bin/cmake
Environment Profile=
Extra Arguments=
Install Directory=file:///usr/local
[Defines And Includes][Compiler]
Name=GCC
Path=gcc
Type=GCC
[Launch]
Launch Configurations=Launch Configuration 0
[Launch][Launch Configuration 0]
Configured Launch Modes=execute
Configured Launchers=nativeAppLauncher
Name=fast
Type=Native Application
[Launch][Launch Configuration 0][Data]
Arguments=-m 22 -bl -s 0 -nt 1 ../bad_cases/HBG010916-1.M0.009.nwk ../bad_cases/HBG010916-1.phy
Dependencies=@Variant(\x00\x00\x00\t\x00\x00\x00\x00\x01\x00\x00\x00\x0b\x00\x00\x00\x00\x02\x00\x00\x00\x1c\x00f\x00a\x00s\x00t\x00c\x00o\x00d\x00e\x00m\x00l\x00.\x00g\x00i\x00t\x00\x00\x00\x08\x00f\x00a\x00s\x00t)
Dependency Action=Build
EnvironmentGroup=
Executable=file:///home/omid/Projects/fastcodeml.git/
External Terminal=konsole --noclose --workdir %workdir -e %exe
Project Target=fastcodeml.git,fast
Use External Terminal=false
Working Directory=
isExecutable=false
[Project]
VersionControlSupport=kdevgit
(((((((((a0009:0.005122,a0005:0.005553):0.021588,(a0000:0.09922,a0003:0.056644):0.214725):0.010754,a0010:0.015175):0.074881,a0001:0.06595):0.010737,a0014:0.314409):0.007601,a0013:0.083805):0.264158,a0007:0.430493):0.340044,a0002:1.259416):0.66615,(((a0008:0.090909,a0011:0.107215):0.183011,(a0012:0.283332,a0004:0.851209):0.052773):0.459232,a0006:0.540195)#1:0.694423);
15 1794
a0011 GTGGCTCAAGAGCTCGATGAGCATATTAGCTATGTGGCAACCAAGGTCTGTCACCTTGGTGATCAGCTAGAGGGGGTGCCTCGACAGCGGGCTGTGGCTCAACGCCTGATGACGTACTTCAATGAATTCCTGGATGGAGACCTGCGCAGTGATGTTTTCAACAATCCAGACAAAATTAAGGAGGCTGCTGATATTATTCAGAAGCTGCATCTTATCGCCCAGGAGCTGCCATTTGACAGATTTGCAGATGTCAAGGCAAAAATTGCAAGTAAGTACCATGATCTGGAGCGGCAGCTAATCCAGGAGTTCACTGCTGCCCAGCGCAGGGGTGAGATCGGGCGCATGCGAGAGGTGGCAGCTGTTCTATTGCACTTCAAGGGCTATGCACACTGCGTCGATGTCTACATCAGGCAATGTCAGGAAGGAGCCTACCTGAGGAATGATGTGTTCGAGGACACCGCGATTCTGTGTCAAAGGGTCAACAAACAGGTGGGCGAGGTGTTTAGCAGCCCAGAGACAGTTATGGCCAAGCTCATTCAGAACATCTTTGAAAACAAATTGCAGTCCCATGTTAAGGATAAGCTGGATGGAACCAGGCAGTCAGATGTAGAACAGTACCTCAAGAACCTCTATGACCTTTATACCAGGACCACGGCCTTGGCTACCAAACTGACAGAGTTCAACTTGGGTTCAGACAAGCACACTTTCTTGTCCAAGCTAATAAAGAGCATCTTTTCCACCTACCTGGAAAGTTATATTGACATGGAGAAAGAATATCTGCGGAGTCGAGGCGCCATGATTTTGCAGCGCTACTATGATTCCAAGAATCACCAGAAACGCTCGATTGGCACCGGCAGTATCCAAGAACTGAAGGAGCGTATCAGACAGCGCACCAACCTGTCCCTTGGTCCTGTCATTGACACCCACGGGGAGACCTTCCTGTCCCCAGAGTTAGTTGTCAATCTGTTGCAGGAGACCCGCCATGCCTTCGAGAGATGCCACAGGCTTTCCGACCCTTCGGACCTGCCAAAAAATGCCTTCTCAATCTTCTTGCTGCTGGTTGAGCATCTTTGCGTGGAACACATTGACTACGCCCTTGAGATTGGCCTCTCAGCGATTCCCTCATCAGATGCCAAGAACGCCAATCTGTACTTCCTGGATGTTGTTCAACAGGCGAACTCTATCTTCCACTTGTTTGACAAACAGTTTCACGACCAGCTAATGCCTCTAATAAGCTCACTGGCCGAGTGCCTGCACAAGAAGAAAGAGGTGATTGAGCAGATGGAAGTGAAACTGGACACAGGAATCGACAGAACGATAAATTGTATGGTGGGGCAAATGAAGCACATCCTAGCAACAGAGCAGAAAAAGACTGATTTTAGGCCTATGATCCAGTACACTACAGCCTGCTCCAAGGTATGCGTGTACGTCAGCCGGCAGGTGGAGCACGTGCGGAAGTCCATGGATGGCAAAAACGTGGACACAGTGCTGACGGAGCTGGGCGTCCGTTTCCACCTCATCCACGAGCACCTCCAACAGTACAGTTACAGCTCAATGGGAGCCATCTGTGACGTGGCTGAATACCGACGGTGTGCCAAGGACTTCAGGGTCCCACTGGTGCTGCAGCTCTTCGACACACTCCACGCCCTTTGTAACCTCCTCGTCGTTGCCCCTGACAACCTGAAGCAGGTCTGCTCAGGCGAACAGCTCACCAATCTGGACCGAAACCTCCTGCATGCGTTCGTCCAGCTCAGAGTGGACTACCGCTCAGCCAGACTGGGCCGCCACTTCAGC
a0013 GTTGCCCAAGAACTAGATGAGCACATCAGCTATGTAGCAACCAAAGTCTGTCACCTTGGAGACCAGTTGGAGGGGGTACCCAGACAACGGGCAGTAGCTCAGAAGTTGATGAAATACTTCAATGAGTTTCTAGATGGAGAACTGAAATCTGATGTTTTTACAAATTCTGAAAAGATAAAGGAGGCAGCAGACATCATTCAGAAGTTGCACCTAATCGCCCAAGAGTTACCTTTTGATAGATTTTCAGAAGTTAAATCTAAAATTGCAAGTAAATACCATGATTTAGAATGCCAGTTGATTCAGGAGTTTACTGGTGCTCAAAGAAGAGGTGAAATCTCCAGAATGAGAGAAGTAGCAGCTGTTTTACTTCATTTTAAGGGTTATTCTCATTGTGTTGATGTTTATATAAAGCAGTGCCAGGAGGGTGCTTACTTGAGAAACGATATATTTGAAGATGCAGCAATACTCTGTCAACGGGTAAACAAACAAGTTGGAGATATCTTTAGTAATCCAGAAACAGTACTGGCTAAACTTATTCAAAATGTATTTGAAATCAAACTACAGAGCTTTGTGAAAGACCAGTTACAAGAATGTTGGAAGTCTGATGCAGAGCAGTATCTCAAAAGTCTCTATGATTTATACACAAGAACCACAAATCTTTCCAGCAAGTTGATGGAGTTTAACTTAGGTACTGATAAACAGACTTTCTTGTCTAAGCTTATCAAGTCCATTTTCATTTCCTATTTGGAGAGCTACATTGAAATAGAGACTGGCTATTTGAAAAGCAGAAGTGCTATGATCCTACAGCGCTATTATGATTCAAAAAACCATCAAAAGAGATCCATTGGCACAGGAGGTATTCAAGATCTGAAAGAGAGAATTAGACAACGCACTAACTTACCACTGGGGCCGAGTATTGATACTCATGGAGAGACTTTCCTGTCCCAGGAAGTGGTGGTTAATCTTTTGCAAGAAACCAAACAAGCCTTTGAAAGATGTCATAGGCTCTCTGATCCTTCTGATTTACCAAGGAATGCCTTTAGAATTTTTACCATTCTTGTGGAATTTTTATGTATTGAACATATTGATTATGCCTTGGAAACAGGACTTGCTGGAATTCCTTCTTCAGATTCTAAGAATGCAAATCTCTATTTTTTGGATGTTGTGCACCAGGCCAATACTATTTTTCATCTTTTTGACAAGCAGTTTAATGATCACCTTATGCCACTAATAAGCTCTTTATCTGAATGCCTTCAGAAAAAAAAAGAAATAATTGAACAGATGGAGATGAAATTGGATACTGGCATTGATAGGACATTAAATTGTATGATTGGACAAATGAAGCATATCTTGGCTGCAGAACAAAAGAAAACAGATTTTAAGCCATTGATTCAGTATACTAATGCCTGTGTTAAAGTCTGTGCTTACGTAAGAAAACAAGTGGAGAAGATTAAAAATTCCATGGATGGGAAGAATGTGGATACAGTTTTGATGGAACTTGGAGTACGTTTTCATCTTATTTATGAGCATCTTCAACAATATTCCTATAGCTGTATGGGTGCAATTTGTGATGTAGCTGAGTATAGGAAGTGTGCCAAAGACTTCAAGATTCCTCTGGTATTACAGCTTTTTGATACTCTGCATGCACTTTGCAATCTTCTGGTAGTAAACCCAGATAATTTAAAGCAAGTCTGCTCAGGAGAACAACTTGCTAATCTGGACAAGAACATTCTTCACTCCTTCGTACAACTTCGTGCTGACTATAGATCTGCCCGCCTTGCTCGACATTTCAGC
a0006 GTAGCCCAGGAGTTGGATGAGCATATCAGCTATGTGGCTACTAAGGTGTGCCATCTGGGAGATCAGCTAGAAGGAGTCCCGAGACAGAGGGCAGTGGCTCAGAGACTTATGACATACTTTAACGAGTTCCTGGATGGAGAGCTGCGCAGTGATGTATTCAACAATCCTGAAAAGATAAAAGAAGCTGCAGACATCATTCAGAAGTTGCACCTGATCGCTCAGGAGCTGCCATTTGACAGATTTTCTGATGTCAAAGCCAAGATAGCAAGTAAATATCATGACCTTGAGCGTCAGTTGATTCAGGAATTCACAGCAGCTCAGAGAAGAGGAGAGATTGGACGCATGCGTGAAGTAGCAGCAGTCCTGCTACATTTTAAGGGATATGCCCACTGTGTTGATGTCTACATCAAGCAGTGTCAAGAGGGAGCATACATGCGGAATGATGTGTTTGAAGACATTGCTATTCTGTGTCAACGGGTTAATAAGCAGGTTGGAGAAGTCTTCTGCAGTCCAGAAACGGTCATGGCTAAACTCATTCAAAGCATCTTTGAGAATAAGATACAGGCTCATGTGAAAGAAAGACTAGATGAGACGCGCAACTCTGATGTGGAGCAATACCTCAAGAACCTCTATGACCTCTACACAAGGACGACAGCACTGGCTGCTAAACTCACAGACTATAACTTGGGCTCAGACAAGCACACATTTCTATCTAAGCTGATAAAGAATATCTTCTCCTGTTATCTGGAGAGCTATATAGACATGGAGCGGCAATATCTGCAGAACCGCAGCGGCATGATTCTTCAGCGCTATTATGATTCCAAGAACCACCAAAAACGACCTGTAGGCACTGGAAGTATCCAGGAGCTAAAAGAGAGAATCAGACAACGCACGAACTTGCCTCTGGGACCCAGTATTGACACACATGGAGAGACTTTGCTCTCACAAGAAGTTGTGGTCAACCTTTTGCAAGAAACAAGGCATGCCTTTGAGAGATGCAACAAGTTGTCAGACCCAGCAGATCTGCCAAAGAATGCCTTCTCCATTTTCCTGATTTTGGTGGAGTACCTGTGTGTGGACCATATAGACTACGCCCTTGAGATTGGGCTGTCAGCCATCCCATCTGCAGATGCCAAAAATGCCAACCTCTACTTTCTGGATGTGGTTCAGCAGGCCAACACAATCTTTCACCTCTTCGATAAGCAGTTTAACGATCATCTTATGCCTCTTATTAGCTCCTTGACGGAGTGCTTGCATAAGAAGAAAGAGGTGATCGAACAAATGGAAGTCAAGCTGGACACTGGGATTGATCGGACACTGAATTGCATGATTGGCCAAATGAAGTACATCCTGACCACTGAACAGAAGAAAACCGACTTCAAGCCAATGATACAGTACACTACAGCATGCTCAAAGGTGTGCGCCTATGTGGGGAAGCAGGTGGAGCGTGTGCGGAGGTCCATGGATGGTAAGAATGTAGACACTGTTTTGACGGAGCTGGGAGTGCGCTTCCACCTCATCCATGAGCACCTGCAGCAGTTCAGCTACAGCTCCATGGGTGCCATCTGTGATGTGGCAGAATACCGCCGCTCTGCCAAAGATTTCCGGGTTCCACTGGTACTCCAACTCTTCGACACACTTCACGCTCTCTGTAACCTTCTGGTCGTTGCACCAGACAACCTCAAACAGGTGTGCTCTGGAGAGCAGCTCACCAACCTGGACCGGAACCTCCTCCACGCTTTCGTTCAGCTCAGAGTAGACTATCGCTCAGCCCGACTCGGCCGGCATTTCAGC
a0000 GTTGCTCAAGAACTAGATGAACACATTAGCTATGTAGCTACCAAAGTGTGTCACCTTGGAGACCAGTTGGAAGGGGTACCTAGACAGCGTGCAGTGGCGCAGAAATTGATGAAATACTTTAATGAGTTTCTAGATGGAGAATTGAAATCTGATGTTTTTACAAATCCTGAAAAGATCAAGGAAGCAGCAGACGTCATTCAGAAACTGCATCTGATCGCCCAGGAGTTACCTTTCGATAGGCAAAAAAAAGTAAAATCCAAAATTGCAAGTAAATACCACGACTTAGAATGCCAGCTGATTCAGGAGTTTACCAGTGCACAACGAAGAGGTGAGGTCTCCCGGATGAGGGAGGTGGCAGCTGTCCTGCTTCATTTTAAGGGTTATTCCCACTGTATTGATGTTTATATAAAGCAGTGCCAGGAGGGTGCTTACTTGAGAAATGATATATTCGAAGACGCAGCAATTCTCTGTCAGCGAGTGAACAAGCAAGTTGGAGATATCTTTAGTAATCCAGAAGCAGTACTGGCTAAGCTTATTCAGAATGTGTTTGAAGTCAAACTACAGAGTTTTGTGAAAGATCAGTTAGAAGAATGTAGGAAATCGGATGCTGAGCAGTATCTTAAAAGTCTGTATGATCTGTACACAAGAACCACCAGTCTTTCCAGCAAATTGATGGAGTTTAACTTAGGTACTGATAAACAGACTTTCTTGTCTAAGCTTATCAAATCCATTTTCGTTTCCTATCTGGAGAACTATATTGAAGTGGAGATTGGATATTTGAAAAGCAGAAGTGCTATGATCCTACAGCGCTATTATGATTCAAAAAACCACCAAAAGAGATCCATTGGCACAGGAGGTATTCAAGATTTGAAAGAAAGGATTAGACAACGTACCAACTTACCACTGGGGCCAAGTATTGACACACATGGGGAGACTTTCCTATCTCAAGAAGTGGTAGTTAATCTTTTACAAGAAACCAAACAAGCCTTTGAAAGATGTCATAGGCTTTCTGATCCTTCTGATTTACCAAGGAATGCCTTTAGAATTTTTACCATTCTTGTGGAATTTTTATGTATTGAGCATATTGATTATGCTTTAGAAACGGGGCTTGCTGGAATTCCATCATCAGATTCTAGGAACGCAAATCTCTATTTTTTGGATGTTGTACAACAGGCCAATACTATTTTTCATCTTTTTGACAAACAGTTTAATGATCACCTAATGCCACTAATAAGCTCTTTGTCTGAATGCCTCCAGAAGAAGAAGGAGATAATTGAGCAGATGGAGATGAAGTTGGACACTGGCATCGATAGGACGTTAAATTGTATGATTGGACAGATGAAGCACATCTTGGCTGCAGAACAAAAGAAAACAGATTTTAAGCCATTGATTCAGTATACTAATGCATGTGTAAAGGTTTGTGCTTATGTAAGAAAACAAGTTGAGAAGATTAAGAATTCCATGGATGGGAAGAATGTGGACACGGTTCTGATGGAGCTCGGAGTACGTTTCCACCTTACTTATGAGCATCTTCAACAATATTCCTACAGTTGTATGGGCGCAATTTGCGACGTTGCTGAATATAGAAAATGTGCCAAAGACTTCAAGATTCCAATGGTATTACATCTTTTTGATACTCTGCATGCACTTTGCAATCTCCTAGTCGTTGCTCCAGATAATTTAAAGCAAGTCTGCTCAGGAGAACAACTGGCCAATCTGGACAAGAACATACTCCACTCCTTCGTCCAGCTTCGAGCTGACTATAGATCCGCCCGCCTGGCTCGGCACTTCAGC
a0014 GTTGCCCAAGAATTAGATGAGCACATCAGCTATGTAGCAACTAAGGTCTGTCACCTTGGTGACCAGCTGGAGGGGGTACCACGGCAACGAGCTGTGGCTCAGAAACTGATGAAATACTTTAATGAGTTTCTAGATGGAGAGTTGAAGTCTGATGTTTTTAAAAATGCTGAAAAGATAAAGGAGGCAGCTGACATTATTCAGAAGTTACATTTAATTGCCCAGGAGTTACCCTTTGATAGATTCTCTGAAGTAAAATCAAAAATAGCAAGTAAGTATCATGATTTAGAATGCCAACTTATTCAGGAATTTACCAATGCTCAAAAAAGAGGTGAAATCTCCAGAATGAGAGAAGTGGCAGCAGTTTTACTTCACTTTAAGGGTTATTCCCACTGTGTTGATGTATATATAAAGCAATGTCAAGAGAATACTAATTTGAGAAGTGATATATTTGAAGATACAGCAATACTCTGCCAACGTGTAAACAAACAAGTTGGAGATATATTTAGTAGTCCAGAAACAGTACTGGCCAAACTTATACAAAATGTGTTCGAAATCAAACTACAGAGTTTTGTGAAAGACCAGTTAGAAGAATGTAGGAAGTCTGATGCAGAACAGTATCTTAAAAATCTCTATGATCTTTACACAAGAACTACCAATCTTTCCAGCAAGTTGATGGAGTTTAACTTAGGTACTGATAAACAGACTTTCTTGTCTAAGCTTATCAAATGCATTTTCATTTCCTATTTGGAGAATTATATTGAGGTGGAGATTGGTTATTTGAAAAGCAGAAGTGCTATGATCCTACAACGCTATTATGATTCAAAAAACCATCAAAAGAGATCCATTGGCACTGGAGGTATTCAAGATCTGAAAGAGAGAATTAGACTACGGACCAACTTACCACTTGGGCCCAGTATTGACACACATGGTGAAACCTTCCTCTCCCAAGAAGTAGTGGTTAATCTTCTGCAGGAAACCAAACAAGCCTTTGAAAGATGTCATAGGCTTTCTGACCCATCTGATTTGCCAAGGAATGCCTTTAGAATTTTTACTGTTCTTGTGGAATTTTTATGTATTGAGCATATTGATTATGCCTTGGAAACAGGACTTGCTGGAATTCCTTCTTCAGATTCTAAAAATGCAAATCTCTACTTTTTGGATGTTGTGCAACAGGCCAACACTATTTTTCACCTTTTTGACAAGCAGTTTAATGATCACCTTATGCCACTGATAAGGTCATTATCTGAATGCCTTCAGAAGAAAAAAGATATAATTGAACAAATGGAGATGAAGCTGGATACTGGTATTGATAGGACTCTGAATTGTATGGTTGGACAGATGAAGCATATCTTGACTGCAGAACAAAAAAAGACTGACTTTAAACCACTGATTCAATATACTAATGCATGTGTTAAAGTCTGTGGTTATGTAAGGAAGCAAGTGGAAAAGATTAGGAATTCTATGGATGGGAAGAATGTGGACACAGTTTTGATGGAATTTGGAGTACGTTTTCATCTTATTTATGAACATCTTCAACAATATTCCTACAGTTGTATGGGTGCAATTTGTGATGTGGCTGAATATAGGAAATGTGCCAAAGACTTCAAGATCCCACTGGTATTACAACTTTTTGATACCCTTCATGCTCTTTGCAACCTTCTGGTGGTGGCTCCAGATAACTTAAAGCAGGTTTGCTCAGGAGAACAACTTGCTAATCTGGACAAGAACATCCTTCACTCCTTTGTGCAGCTCCGGGCTGACTATCGGTCTGCCCGCTTGGCTCGGCACTTCAGC
a0010 GTTGCCCAAGAACTAGATGAGCACATTAGCTATGTAGCAACTAAAGTCTGTCACCTTGGAGACCAGTTAGAGGGGGTACCCAGACAACGGGCAGTGGCTCAGAAATTGATGAAATACTTTAATGAGTTTCTAGATGGAGAATTGAAATCTGATGTTTTTACAAATTCTGAAAAGATAAAGGAAGCAGCAGACATCATTCAGAAGTTGCACCTAATTGCCCAAGAGTTACCTTTTGATAGATTTTCAGAAGTTAAATCCAAAATTGCAAGTAAATACCATGATTTAGAATGCCAGCTGATTCAGGAGTTTACCAGTGCTCAAAGAAGAGGTGAAATCTCCAGAATGAGAGAAGTAGCAGCAGTTTTACTTCATTTTAAGGGTTACTCCCATTGTGTTGATGTTTATATAAAGCAGTGCCAGGAGGGTGCTTATTTGAGAAATGATATATTTGAAGATGCTGCAATACTCTGTCAACGAGTGAACAAACAAGTTGGAGATATCTTCAGTAATCCAGAAACAGTCCTGGCTAAACTTATTCAAAATGTATTTGAAATCAAACTACAGAGTTTTGTGAAAGAGCAATTAGAAGAATGTAGGAAGTCTGATGCAGAGCAGTATCTCAAAAATCTCTATGATCTCTATACAAGAACCACCAATCTTTCCAGCAAGCTGATGGAGTTTAATTTAGGTACTGATAAACAGACTTTCTTGTCTAAGCTTATCAAATCCATTTTCATTTCCTATTTGGAGAACTATATTGAGGTGGAGACTGGATATTTGAAAAGCAGAAGTGCTATGATCCTTCAGCGCTATTATGATTCGAAAAACCATCAAAAGAGATCCATTGGCACAGGAGGTATTCAGGATTTGAAGGAGAGAATTAGACAACGTACCAACTTACCACTTGGGCCAAGTATCGATACTCATGGGGAAACTTTTCTATCCCAGGAAGTGGTGGTTAATCTTTTACAAGAAACCAAACAAGCCTTTGAAAGATGTCATAGGCTCTCTGATCCTTCTGACTTACCAAGGAATGCCTTCAGAATTTTTACCATTCTTGTGGAATTTTTATGTATTGAGCATATTGATTATGCTTTGGAAACAGGACTTGCTGGAATTCCCTCTTCAGATTCTAGGAATGCAAATCTTTATTTTTTGGATGTTGTGCAACAGGCCAATACTATTTTTCATCTTTTTGACAAACAGTTTAATGATCACCTTATGCCACTAATAAGCTCTTTATCTGAATGCCTTCAGAAGAAAAAAGAAATAATTGAACAAATGGAGATGAAATTGGATACTGGCATTGACAGGACATTAAATTGTATGATTGGACAGATGAAGCATATTTTGGCTGCAGAACAAAAGAAAACAGATTTTAAGCCATTGATTCAATATACTAATGCTTGTGTAAAAGTCTGTGCTTACGTAAGAAAACAAGTGGAGAAGATTAAAAATTCCATGGATGGGAAGAATGTGGATACAGTTTTGATGGAACTTGGAGTACGTTTTCATCTTATCTATGAGCATCTTCAACAATATTCCTACAGTTGTATGGGTGCAATTTGTGATGTAGCTGAATATAGGAAGTGTGCCAAAGACTTCAAGATTCCAATGGTATTACATCTTTTTGATACTCTGCATGCTCTTTGCAATCTTCTGGTAGTTGCCCCAGATAATTTAAAGCAAGTCTGCTCAGGAGAACAACTTGCTAATCTGGACAAGAATATACTTCACTCCTTCGTACAACTTCGTGCTGATTATAGATCTGCCCGCCTTGCTCGACACTTCAGC
a0003 GTTGCTCAAGAGCTAGATGAGCACATTAGCTATGTAGCTACCAAAGTGTGTCACCTTGGAGACCAGTTGGAAGGGGTACCTAGGCAACGTGCAGTGGCACAGAAATTGATGAAATACTTTAATGAGTTTCTAGATGGAGAATTGAAATCTGATGTTTTTACAAATTCTGAAAAGATAAAGGAAGCAGCAGACGTCATTCAAAAACTGCATCTGATTGCCCAGGAGTTACCTTTCGATAGGTATTCTCAAGTAAAATCAAAAATTGCAAGTAAATACCATGACTTAGAATGCCAGCTGATTCAGGAGTTTACAAGTGCCCAAAGAAGAGGGGAGGTCTCCCGGATGAGGGAGGTGGCTGCAGTCCTCCTTCATTTTAAGGGTTATTCCCATTGTATTGATGTTTATATAAAGCAGTGCCAGGAGGGTGCTTACTTGAGAAATGACATATTTGAAGATGCAGCAATACTCTGTCAGCGAGTGAACAAGCAGGTTGGAGACATCTTTAGTAATCCAGAAGCAGTGCTGGCTAAGCTTATTCAGAGTGTGTTTGAAATCAAACTACAGAGTTTTGTGAAGGATCAGTTAGAAGAATGTAGGAAATCTGATGCTGAGCAGTATCTTAAAAGTCTCTATGATCTGTATACAAGAACCACCGGTCTTTCCAGCAAATTGATGGAGTTTAACTTAGGTACTGATAAACAGACTTTCTTGTCTAAGCTTATCAAATCCATTTTCATTTCCTATCTGGAGAACTATATTGAAGTGGAGATTGGATATTTGAAAAGCAGAAGTGCTATGATCCTACAGCGCTATTATGATTCAAAAAACCACCAAAAGAGATCCATTGGCACAGGAGGTATTCAAGATTTGAAAGAAAGGATTAGACAACGTACCAACTTACCACTGGGGCCAAGTATTGATACACATGGGGAAACTTTCCTATCTCAAGAAGTGGTAGTTAATCTTTTACAAGAAACCAAACAAGCCTTTGAAAGATGTCATAGGCTTTCTGATCCTTCTGATTTACCAAGGAATGCCTTTAGAATTTTTACCATTCTTGTGGAATTTTTATGTATTGAGCATATTGATTATGCTTTAGAAACGGGTCTTGCTGGAATCCCATCATCAGATTCTAGGAATGCAAATCTCTACTTTTTGGATGTTGTACAACAGGCCAATACTATTTTTCATCTTTTTGACAAACAGTTTAATGATCACCTAATGCCACTAATAAGCTCTTTATCTGAATGCCTCCAGAAGAAAAAAGAGATAATTGAGCAGATGGAGATGAAATTGGATACTGGCATTGATAGGACATTAAATTGTATGATTGGACAGATGAAGCATATCTTGGCTGCAGAACAAAAGAAAACAGATTTTAAGCCATTGATTCAGTATACTAATGCATGTGTAAAAGTTTGTGTTTATGTAAGAAAACAAGTTGAGAAGATTAAAAATTCCATGGATGGGAAGAATGTGGACACAGTTCTGATGGAACTTGGAGTACGTTTTCATCTTATTTATGAACATCTTCAACAATATTCCTATAGTTGTATGGGTGCAATTTGCGACGTGGCTGAGTATAGAAAATGTGCCAAAGACTTCAAGATTCCAATGGTATTACATCTTTTTGATACTCTGCATGCACTTTGCAATCTCCTGGTCGTGGCTCCAGATAATTTAAAACAAGTCTGCTCGGGAGAACAACTTGCCAATCTGGACAAGAACATACTCCACTCCTTTGTACAACTTCGTGCTGACTATAGATCTGCCCGCCTGGCGCGACACTTCAGC
a0001 GTTGCCCAAGAACTAGATGAGCACATCAGCTATGTAGCAACCAAAGTTTGTCACCTTGGAGACCAGTTGGAAGGGGTACCTAGACAACGGGCAGTTGCTCAGAAATTGATGAAATACTTTAATGAATTTCTAGATGGAGAATTGAAGTCTGATGTTTTTACAAATTCTGAAAAGATAAAGGAGGCAGCAGACATCATTCAGAAGTTGCATTTAATCGCCCAGGAGTTACCTTTTGACAGGTTTTCAGAAGTAAAATCCAAAATTGCAAGTAAATACCATGACTTAGAATGCCAGCTAATTCAAGAGTTTACCAGTGCTCAAAGAAGAGGTGAAATCTCCAGAATGAGAGAAGTAGCTGCAGTTTTGCTTCATTTTAAGGGTTATTCCCATTGTGTTGATGTTTATATAAAGCAGTGCCAGGAGGGTGCTTACTTGAGAAACGATATATTTGAAGATGCAGCAATACTCTGTCAACGGGTTAACAAACAAGTTGGAGATATCTTTAGTAATCCAGAAACAGTACTGGCTAAGCTTATTCAAAATGTATTTGAAATCAAACTACAGAGTTTTGTGAAAGACCAGTTAGAAGAATGTAGGAAGTCTGATGCAGAGCAGTATCTCAAAAATCTCTATGATTTATATACAAGAACTACAAATCTTTCCAGCAAGTTGATGGAGTTTAACTTAGGTACTGATAAACAGACTTTCTTGTCTAAGCTTATCAAATCCATTTTCATTTCCTATTTGGAGAACTATATTGAGGTGGAGACTGGATATTTGAAAAGTAGAAGTGCTATGATCCTACAGCGCTATTATGACTCAAAAAACCATCAAAAGAGATCCATTGGCACAGGAGGTATTCAGGATTTGAAAGAGAGAATTAGACAACGTACCAACTTACCGCTGGGGCCAAGTATCGATACTCATGGAGAAACTTTCCTATCTCAAGAAGTGGTGGTTAATCTTTTACAAGAAACTAAACAGGCCTTTGAAAGATGTCATAGGCTCTCAGATCCTTCTGATTTACCAAGGAATGCCTTTAGAATTTTTACCATTCTTGTGGAATTTTTATGTATTGAGCATATTGATTATGCTTTGGAAACAGGACTTGCTGGAATTCCTTCTTCAGATTCTAGGAATGCAAATCTCTATTTTTTGGACGTTGTACAACAGGCCAATACTATTTTTCATCTTTTTGACAAGCAGTTTAATGATCACCTTATGCCACTAATAAGCTCTTTATCTGAATGCCTTCAGAAGAAAAAAGAAATAATTGAACAAATGGAGATGAAATTGGATACTGGCATTGATAGGACATTAAATTGTATGATTGGACAGATGAAACATATCTTGGCTGCAGAACAAAAGAAAACAGATTTTAAGCCATTGATTCAATATACTAATGCCTGTGTTAAAGTCTGTGCTTATGTAAGAAAGCAAGTGGAAAAGATTAAAAATTCCATGGATGGGAAGAATGTGGATACAGTTTTGATGGAACTTGGAGTACGTTTTCATCTTATTTATGAGCATCTTCAACAATACTCCTACAGTTGTATGGGTGCAATTTGTGATGTAGCTGAATATAGGAAGTGTGCCAAAGACTTCAAGATTCCACTGGTATTACAGCTTTTTGATACTCTGCATGCACTTTGCAATCTTCTGGTAGTTGCTCCAGATAATTTAAAGCAAGTCTGCTCAGGAGAACAACTTGCTAATCTGGACAAGAACATTCTTCACTCCTTCGTACAACTTCGTGCTGACTATAGATCTGCCCGTCTTGCTCGACATTTCAGC
a0007 GTTGCCCAAGAACTAGATGAGCACATCAGCTATGTAGCAACTAAGGTCTGTCACCTTGGCGACCAACTGGAGGGGGTACCGCGGCAACGGGCTGTGGCTCAGAAGCTGATGAAATACTTTAATGAGTTTCTGGATGGAGAGCTGAAGTCTGATGTTTTTACAAACTCTGAAAAGATTAAAGAGGCAGCTGATATTATTCAGAAACTGCATTTGATTGCACAGGAACTGCCTTTTGACAGGTTTTCTGAAGTAAAATCAAAGATAGCAAGTAAGTACCATGACTTAGAGTGCCAGCTAATTCAGGAGTTTACCAGCGCGCAGCGGAGAGGTGAAATATCCAGAATGAGAGAAGTAGCAGCTGTCTTGCTCCATTTTAAGGGCTATTCCCATTGTGTTGATGTGTACATAAAACAGTGTCAAGAGGGTGCATTCCTGAGGAATGATGTGTTTGAAGATGCAGCCATTCTCTGCCAGCGAGTGAATAAGCAAGTTGGAGAAGTCTTCAGCAATCCAGAGACTGTGCTAGCCAAACTCATCCAAAACATCTTTGAAGTTAAACTTCAGAGTTATGTAAAGGACCAGCTGGAAGAACACAGGAAATCGGATGCAGAACAGTATCTTAAGAATCTTTATGATCTGTATACAAGAACGACTAATCTTTCAAGCAAATTGATGGAATTTAACTTGGGCACTGATAAGCAGACTTTCTTGTCTAAGCTTATCAAATCCATTTTCATTTCCTACTTGGAGAATTACATTGAGGTGGAAATTGGTTATTTGAAAAGTAGGAGCGCGATGATTCTGCAACGTTATTATGATTCCAAAAACCACCAGAAGAGGTCTATTGGCACTGGAGGTATTCAAGACCTCAAGGAAAGAATAAGGCAACGTACAAACTTGCCACTGGGGCCAAGCATTGACACCCATGGAGAAACTTTTCTCTCACAAGAAGTGGTGGTTAACCTTCTGCAAGAAACCAAACAAGCTTTTGAGAGATGTCACAGACTCTCTGATCCATCTGACTTACCGAAGAACGCTTTCAGAATTTTTTCTATGCTTGTAGATTTCTTATGCACTGAACACATTGATTATGCGTTAGAAACAGGCCTTGCTGGAATTCCCTCTTCTGATTCAAAGAACGCAAATCTTTATTTCTTGGATGTTGTCCACCAGGCCAATACTATTTTCCATTTGTTTGACAAACAGTTCAATGATCATCTGATGCCATTGATCAGTTCGTTATCTGAATGCCTTCAGAAGAAAAAGGATATCATAGAACAAATGGAAGTGAAGCTGGATATGGGCATTGATCGGACTTTGAATTGTATGATTGGACAGATGAAGCACATCTTGGCTGCAGAGCAGAAAAAGACAGATTTTAAACCATTGATTCAATATACTAACGCTTGTGTTAAAGTCTGCAGCTATGTTAGAAAGCAGGTGGAAAAGATTAGGAAGTCTATGGATGGTAAGAACGTGGACACAGTATTGATGGAGTTTGGAGTTCGTTTCCATCTCATCTATGAGCACCTGCAGCAATATTCCTACAGCTGCATGGGTGCTATTTGTGACGTGGCTGAATATAGAAAGTGTGCCAAAGACTTCAAGATTGCGCTGGTGTTGCAGCTCTTTGATACTTTGCATGCACTTTGCAATCTTCTGGTTGTAGCCCCGGATAACTTAAAGCAAGTTTGCTCAGGTGAACAACTTGCTAATCTGGACAAGAACATCCTTCACTCCTTTGTTCAGCTGCGTGTTGATTATAGGTCTGCACGTCTTGCTCGTCACTTCAGC
a0005 GTTGCCCAAGAACTAGATGAGCACATTAGCTATGTAGCAACTAAAGTCTGTCACCTTGGAGACCAGTTAGAGGGGGTACCCAGACAACGGGCAGTGGCTCAGAAATTGATGAAATACTTTAATGAGTTTCTAGATGGAGAATTGAAATCTGATGTTTTTACAAATTCTGAAAAGATAAAGGAAGCAGCAGACATCATTCAGAAGTTGCACCTAATTGCCCAAGAGTTACCTTTTGATAGGCAAAGCAAAGTTAAATCCAAAATTGCAAGTAAATACCATGATTTAGAATGCCAGCTGATTCAGGAGTTTACCAGTGCTCAAAGAAGAGGTGAAATCTCCAGAATGAGAGAAGTAGCAGCAGTTTTACTTCATTTTAAGGGTTATTCCCATTGTGTTGATGTTTATATAAAGCAGTGCCAGGAGGGTGCTTATTTGAGAAATGATATATTTGAAGACGCTGGAATACTCTGTCAAAGAGTGAACAAACAAGTTGGAGATATCTTCAGTAATCCAGAAACAGTCCTGGCTAAACTTATTCAAAATGTATTTGAAATCAAACTACAGAGTTTTGTGAAAGAGCAGTTAGAAGAATGTAGGAAGTCCGATGCAGAGCAATATCTCAAAAATCTCTATGATCTGTATACAAGAACCACCAATCTTTCCAGCAAGCTGATGGAGTTTAATTTAGGTACTGATAAACAGACTTTCTTGTCTAAGCTTATCAAATCCATTTTCATTTCCTATTTGGAGAACTATATTGAGGTGGAGACTGGATATTTGAAAAGCAGAAGTGCTATGATCCTACAGCGCTATTATGATTCGAAAAACCATCAAAAGAGATCCATTGGCACAGGAGGTATTCAAGATTTGAAGGAAAGAATTAGACAGCGTACCAACTTACCACTTGGGCCAAGTATCGATACTCATGGGGAGACTTTTCTATCCCAAGAAGTGGTGGTTAATCTTTTACAAGAAACCAAACAAGCCTTTGAAAGATGTCATAGGCTCTCTGATCCTTCTGACTTACCAAGGAATGCCTTCAGAATTTTTACCATTCTTGTGGAATTTTTATGTATTGAGCATATTGATTATGCTTTGGAAACAGGACTTGCTGGAATTCCCTCTTCAGATTCTAGGAATGCAAATCTTTATTTTTTGGACGTTGTGCAACAGGCCAATACTATTTTTCATCTTTTTGACAAACAGTTTAATGATCACCTTATGCCACTAATAAGCTCTTTATCTGAATGCCTTCAGAAGAAAAAAGAAATAATTGAACAAATGGAGATGAAATTGGATACTGGCATTGATAGGACATTAAATTGTATGATTGGACAGATGAAGCATATTTTGGCTGCAGAACAGAAGAAAACAGATTTTAAGCCATTGATTCAATATACTAATGCCTGTGTAAAAGTCTGTGCTTACGTAAGAAAACAAGTGGAGAAGATTAAAAATTCCATGGATGGGAAGAATGTGGATACAGTTTTGATGGAACTTGGAGTACGTTTTCATCTTATCTATGAGCATCTTCAACAATATTCCTACAGTTGTATGGGTGCCATTTGTGATGTAGCCGAATATAGGAAGTGTGCCAAAGACTTCAAGATTCCAATGGTATTACATCTTTTTGATACTCTGCATGCTCTTTGCAATCTTCTGGTAGTTGCCCCAGATAATTTAAAGCAAGTCTGCTCAGGAGAACAACTTGCTAATCTGGACAAGAATATACTTCACTCCTTCGTACAACTTCGTGCTGATTATAGATCTGCCCGCCTTGCTCGACACTTCAGC
a0004 GTGGCCCAGGAGCTCGATGAGCACATAAGCTATGTGGCGACAAAGGTTTGCCACCTTGGCGACCAGCTGGAGGGGGTGCCTCGACAGCGGGCCGTGGCTCAGCGTCTAATGACCTACTTCAACGAGTTCTTGGATGGAGACCTACGCAGTGATGTCTTCAATAACCCCGACAAGATTAAGGAGGCCGCTGATATAATTCAGAAGCTGCATCTCATCGCCCAGGAACTGCCGTTCGACAGATTTGCAGATGTCAAGGCAAAAATTGCAAGTAAGTACCATGACCTGGAGAGGCAGTTGATCCAGGAGTTCACAGCTGCCCAGCGCATGGGGGAGATCGGACGGATGCGGGAGGTGGCAGCGGTTCTGTTACATTTCAAGGGCTACGCGCACTGTGTGGATGTCTACATCAAGCAGTGTCAGGAAGGGGCCTACATGAGGAACGATGTGTTCGAGGACACTGCGGCCCTCTGCCAGAGGGTCAACAAGCAGGTGGGGGAGGTCTTCAGCAGCCCAGAGACTGTGATGGCCAAACTCATTCAGAACATCTTTGAAAACAAATTGCAGAGCCACGTCAGAGAAAAACTGGACAAAACACGACACTCTGATGTGGAGCAATACCTTAAGAACCTCTATGATCTCTACACCAGGACCACCGCATTGGCCACTAAACTGACTGAGTTCAACCTCGGCTCGGACAAGCACACTTTCCTGTCTAAGCTGATAAAGAGCATATTCTCCTCATACCTCGAAAGCTACATTGAGATCGAGAGGGAATACCTTCGCACCCGAGGGGCCTTGATTCTGCAGCGCTACTACGACTCCAAGAATCACCAGAAGCGCCCAATCGGCACCGGCAGTATCCAAGAACTGAAGGAGCGGATCAGACAGCGCACCAACCTCCCTCTCGGCCCTATGATTGACACCCATGGGGAGACCTTTCTGTCTCCTGAGCTAGTTGTCAACCTGCTGCAGGAGACGCGTCATGCCTTTGAGAGATGCAACAGGCTTTCAGATCCTTCAGACCTGCCCAAGAATGCCTTCTCCATCTTCCTGCTGCTGGTCGACCATCTGTGTGTGGATCACATTGACTACGCCCTAGAGATTGGCCTCTCAGCAATTCCCTCATCGGATGCCAAGAATGCCAACCTCTACTTCCTGGACGTCGTTCAACAGGCAAACTCTATCTTCCACTTGTTTGACAAGCAGTTTAATGACCAGCTCATGCCTCTTATAAGCTCCTTGGCCGAGTGCCTGCACAAGAAGAAAGAGGTGATTGAGCAGATGGAAGTGAAACTGGACACAGGAATTGACAGTACTGCTGCATGTGATGTGTCTCAGATGTCACCAGNACCCCAAGCAATCCAGGCTAGAATGCATTTTAAACCCCTCCCGTCGTTTCTTGCTTCTCGAATAAAAGAAGGGGATTCGCCCATCCGGCAGGTTGAGATATGTGTGATGTCCTCGGACCGGAAAAACGTGGGACCCGTGCTGCAAAGTTGGGGTGTTTCGTTTGGGTTAACACAGAGCAATCTACACGCGTTCAGTTACTGCTCAATGGGTGCGCTCTGCCCTTTTGCGGGGGGGAGATCCTGCAGCAAACCTTATAAAGTACCTTTGGTGCTGCAGCTCTTCGACACACTTCACGCCCTCTGCAACCTCCTGGTGGTTGCCCCCGACAACCTGAAGCAGGTTTGTTCAGGTGAGCAGCTGACCAATCTGGACCGAAACCTCCTGCACGCCTTCGTCCAGCTCCGAGTGGACTACCGCTCGGCCAGGCTGGGCCGACACTTCAGT
a0009 GTTGCCCAAGAGCTAGATGAGCACATTAGCTATGTAGCAACTAAAGTCTGTCACCTTGGAGACCAGTTAGAGGGGGTACCCAGACAACGGGCAGTGGCTCAGAAATTGATGAAATACTTTAATGAGTTTCTAGATGGAGAATTGAAATCTGATGTTTTTACAAATTCTGAAAAGATAAAGGAAGCAGCAGACATCATTCAGAAGTTGCACCTAATTGCCCAAGAGTTACCTTTTGATAGGCAAAGCAAAGTTAAATCCAAAATTGCAAGTAAATACCATGATTTAGAATGCCAGCTGATTCAGGAGTTTACCAGTGCTCAAAGAAGAGGTGAAATCTCCAGAATGAGAGAAGTAGCAGCAGTTTTACTTCATTTTAAGGGTTATTCCCATTGTGTTGATGTTTATATAAAGCAGTGCCAGGAGGGTGCTTATTTGAGAAATGATATATTTGAAGATGCTGGAATACTCTGTCAAAGAGTGAACAAACAAGTTGGAGATATCTTCAGTAATCCAGAAACAGTCCTGGCTAAACTTATTCAAAATGTATTTGAAATCAAACTACAGAGTTTTGTGAAAGAGCAGTTAGAAGAATGTAGGAAGTCTGATGCAGAGCAATATCTCAAAAATCTCTATGATCTGTATACAAGAACCACCAATCTTTCCAGCAAGCTGATGGAATTTAATTTAGGTACTGATAAACAGACTTTCTTGTCTAAGCTTATCAAATCCATTTTCATTTCCTATTTGGAGAACTATATTGAGGTGGAGACTGGATATTTGAAAAGCAGAAGTGCTATGATCCTACAGCGCTATTATGATTCGAAAAACCATCAAAAGAGATCCATTGGCACAGGAGGTATTCAAGATTTGAAGGAAAGAATTAGACAGCGTACCAACTTACCACTTGGGCCAAGTATCGATACTCATGGGGAGACTTTTCTATCCCAAGAAGTGGTGGTTAATCTTTTACAAGAAACCAAACAAGCCTTTGAAAGATGTCATAGGCTCTCTGATCCTTCTGACTTACCAAGGAATGCCTTCAGAATTTTTACCATTCTTGTGGAATTTTTATGTATTGAGCATATTGATTATGCTTTGGAAACAGGACTTGCTGGAATTCCCTCTTCAGATTCTAGGAATGCAAATCTTTATTTTTTGGACGTTGTGCAACAGGCCAATACTATTTTTCATCTTTTTGACAAACAGTTTAATGATCACCTTATGCCACTAATAAGCTCTTTATCTGAATGCCTTCAGAAGAAAAAAGAAATAATTGAACAAATGGAGATGAAATTGGATACTGGCATTGATAGGACATTAAATTGTATGATTGGACAGATGAAGCATATTTTGGCTGCAGAACAGAAGAAAACAGATTTTAAGCCATTGATTCAATATACTAATGCCTGTGTAAAAGTCTGTGCTTACGTAAGAAAACAAGTGGAGAAGATTAAAAATTCCATGGATGGGAAGAATGTGGACACAGTTTTGATGGAACTTGGAGTACGTTTTCATCTTATCTATGAGCATCTTCAACAATATTCCTACAGTTGTATGGGTGCAATTTGTGATGTAGCCGAATATAGGAAGTGTGCCAAAGACTTCAAGATTCCAATGGTATTACATCTTTTTGATACTCTGCATGCTCTTTGCAATCTTCTGGTAGTTGCCCCAGATAATTTAAAGCAAGTCTGCTCAGGAGAACAACTTGCTAATCTGGACAAGAATATACTTCACTCCTTCGTACAACTTCGTGCTGATTATAGATCTGCCCGCCTTGCTCGACACTTCAGC
a0012 GTGGCCCAAGAACTCGATGAACACATAAGCTACGTTGCCACCAAGGTTTGTCACCTAGGTGACCAGCTGGAGGGGGTGCCTCGCCAGAGGGCCGTGGCTCAGCGTCTCATGACTTACTTTAACGAGTTTTTGGATGGAGATCTGCGTAGCGATGTTTTCAATGACCCAGACAAGATTAAGGAAGCTGCTGATATAATTCAGAAGCTGCATCTCATTGCCCAGGAGCTGCCATTTGACAGATTTGCAGATGTCAAAGCAAAAATTGCAAGCAAATACCACGACCTGGAGAGGCAGTTAATCCAGGAGTTTACTGCAGCCCAGCGCAGGGGTGAGATTGGTCGTATGCGGGAGGTTGCAGCAGTTCTATTACATTTCAAGGGTTATGCACACTGCGTGGACGTCTACATCAAGCAGTGTCAGGAAGGTGCCTACACGAGGAACGATGTGTTTGAAGACACCGCAGCGCTTTGCCAGAGGGTCAACAAGCAGGTGGCCGAGGTCTTCAGCAGTCCAGAGACAGTCATGGCTAAACTCATCCAGAATATCTTTGAAAACAAACTACAGGCGCACGTTAGAGAGAAACTGGATGGAACTCGACAGTCTGATGCAGAACAGTACCTCAAAAACCTCTATGACCTTTACACCAGGACCACAGCATTGGCTACCAAGCTAACAGAGTTCAACCTTGGTTCAGACAAGCATACGTTCCTTTCCAAGCTGATAAAAAGCATCTTTTCCTCTTATTTGGAAAGTTACATTGACATGGAAAGGGAATACCTTCGTAATCGAGGTGCCATGATTCTGCAACGATACTATGACTCAAAGAATCACCAGAAACGTGCAATAGGCTCTGGCAGTATTCAGGAGCTCAAGGAGCGCATCAGACAGCGCACCAACCTTCCACTGGGCCCCAGCCTTGACACCCATGGAGAGACCTTCCTGTCCCCCGAGCTGGTTGTTAATCTGCTGCAGGAGACTCGGCACGCGTTTGAGAGGTGTCACAGGCTTTCAGATCCATCTGATCTGCCTAAAAATGCCTACTCCATCTTCCTACTGCTGGTTGAACATCTGTGTGTGGACCACATCGACTACGCTCTGGAGATTGGCCTTTCAGCGATTCCCTCATCCGATGCCAAGAATGCCAACCTGTACTTCCTGGATGTTGTTCAACAGGCAAACTCCATCTTCCACTTGTTTGACAAGCAGTTTAATGACCAGCTGATGCCTCTTATAAGTTCACTGGCAGAGTGCTTGCAGAAGAAGAAAGAAGTGATCGAACAGATGGAAGTAAAACTGGACACTGGAATTGACAGGACACTAAACTGTATGGTGGGGCAAATGAAGCACATCCTGGCAACAGAGCAGAAAAAAACAGATTTCCGGCCCATGATCCAGTACACCACAGCCTGCTCAAAGGTCTGCGCATACGTCAGTCGGCAGGTGGAGCACGTGCGCAAGTCCATGGATGGGAAAAACGTGGACACGGTGCTGACGGAGTTGGGGGTTCGGTTTCATCTCATTCACGAGCATCTACAGCAGTTCAGCTACAGCTCAATGGGCGCCATCTGTGACGTGGCTGAATACCGCAGATGCGCCAAGAATTTCAGGGTCCCTCTGGTGCTTCAGCTCTTTGACACACTCCACGCCCTCTGTAATCTCCTGGTGGTTGCTCCTGACAACCTGAAGCAAGTTTGCTCAGGTGAGCATCTCACCAATCTGGACCGGAACCTCCTGCATGCTTTTGTCCAGCTCCGAGTGGACTACCGTTCTGCCAGACTGGGCCGACACTTCAGT
a0002 GTAACTGGGGGAGGGCAGCAGTACTGCTGTACTGGCGCTTTGGCGACAAGTCGCCACGACAATACCCACAGAGGTTTTCCCGATAAGGAATCTGTAAGTTTGAAACTGATGACATATTTTAATGAGTTTCTAGATGGTGAACTGCGGTCCGATGTTTTTAACAACCCTGAAAAGATAAAAGAGGCAGCTGATATCATTCAGAAACTGCATTTAATTGCCCAAGAGCTTCCCTTTGACAGGTTTGCAGAAGTAAAATCAAAGATTGCAAGTAAATATCATGATTTGGAGCACCAGCTGATTCAAGAATTCACAAGTGCGCAGAGAAGAGGTGAAATATCTCGCATGAGAGAAGTTGCTGCTGTTTTACTTCATTTCAAGGGCTATTCTCATTGTGTCGACGTGTACATAAACCAGTGTCAAGAGGGAGCATATTTAAAATATGATATATTTGAAAACTCTGCTGTGTTGTGTCAACGCGTGAATAGAGAAGTTGGAGATATATTCAGTAATCCAGAAATTGTTTTGGCCAAGCTTATCCAAAACATTTTTGAAGTCAAGATTCAGAGCTGTGTTAAAGAGCAGCTGGATGAATGCAGAAAATCTGATGCCGAACAATACCTTAAGAGTCTTTATGATCTGTATACAAGGACTACAGGTCTCTCAAGTAAACTGATGGAGTTCAATCTGGGAACGGACAAACAGACCTTTCTGTCAAAGTTAATAAAGTCCATTTTCATCAGCTACCTGGAGAACTACATTGATGTTGAAACTGCCTACTTGCGAAGTCGAAGTTCTGTGATTTTACAGCGTTATTATGACTCTAAGAATCACCAGAAGAGACCTATTGGAGGTGGGGGAATTCAAGATCTAAAGGAAAGGATAAGGCAGCGTACAAACCTCCCTTTGGGACCTAGTATTGACACACACGGAGAGACATTTTTATCTCAAGAAGTTGTGGTTAACTTGCTGCAAGAAACAAAGCATGCCTTTGAGCGATGTCATAAGCTTTCAGATCCATCAGATCTCCCAAAGAACGCTTTTAGAATATTTTCCATTCTTGTGGATTATTTATGCATTGAACATATTGATTATGCACTGGAAATAGGTTTAGTAGCAATACCATCTCCAGATTCAAAGAATGCCAATCTATATTTTTTCGATGTTGTGCATCAGGCCAATACGATTTTCCATTTATTTGATAAACAGTTCAATGATCATCTCATGCCATTAATTAGTTCACTTACTGAGTGTCTTCAAAAGAAAAAAGAAATAATAGAACAGATGGAGGTGAAACTAGATACTGGAATTGACAGAACAATAAATTGCATGGTTGGCCAAATGAAACAAATACTGGCAGCAGAGCAAAAAAAGACAGATTTCAAACCATTAATCCAATACACTACAGCATGTGTGAAAGTTTGCCTTTATGTCCGAAAGCAAGTAGAGAAGATAAGGAACTCAATGGATGGAAAGAATGTGGACACAGTGCTTATGGAGCTGGGTGTGCGCTTCCATCTCATTTATGAGCATCTCCAGCAATTTTCGTACAGCTCAATGGGAGCAATTTGTGATGTTGCAGAATATAGAAGATGTGCCAAGGACTTTAAGATTCCACTTGTATTGCAACTTTTTGACACTCTTCACTCGCTCTGCAACCTCCTGGTGGTGGCCCCTGACAATTTGAAGCAAGTTTGCTCAGGGGAACAGCTTGCCAACCTAGACAAGAATATCCTACATTCCTTTGTGCAGCTGCGAGCTGACTACAGACCTGCGCGCCTTGCCAGACACTTCAGC
a0008 GTGGCCCAAGAGCTGGATGAGCATATTAGCTACGTGGCAACCAAGGTTTGCCATCTTGGTGACCAGCTGGAGGGGGTGCCTCGGCAGCGGGCTGTGGCTCAGCGCCTGATGACATACTTTAATGAGTTCCTGGATGGAGACCTGCGCAGTGACGTCTTCAACAATCCAGACAAAATTAAAGAGGCTGCTGATATTATTCAGAAGCTGCACCTTATCGCTCAGGAGCTGCCATTTGACAGATTTCCTGATGTCAAGGCAAAAATTGCAAGTAAGTACCATGACCTGGAGCGGCAGTTAATCCAGGAGTTTACCGCTGCCCAGCGCAGGGGGGAGATTGGGCGCATGAGGGAGGTGGCAGCTGTTCTACTGCATTTCAAGGGCTATGCTCACTGCGTGGACGTCTACATCAAGCAGTGTCAAGAAGGAGCCTACCTGAGGAACGATGTGTTCGAGGACACCGCGATCCTGTGTCAAAGGGTCAACAAACAGGTGGGCGAGGTGTTTAGCAGCCCAGAGACGGTTATGGCCAAGCTCATTCAGAACATCTTTGAAAACAAATTGCAGTCCCATGTTAAGGACAGGCTGGATGGAACCAGGCATTCAGATGTAGAACAGTACCTCAAGAACCTCTATGACCTTTACACCAGGACCACAGCCTTGGCCACCAAATTGACAGAGTTCAACTTGGGCTCAGACAAACACACTTTCTTGTCCAAGCTGATAAAGAGCATATTTTCCACGTATCTAGAAAGTTACATTGACATGGAGAAAGAATATCTACGTAACCGAGGCGCTATGATATTGCAGCGCTACTATGACTCCAAGAATCACCAGAAACGCTCGATTGGCACCGGCAGTATCCAGGAGCTGAAGGAGCGTATCAGACAGCGCACCAACCTGTCCCTCGGCCCTGTCATCGACACCCACGGGGAGACCTTCCTGTCGCCAGAGTTGGTTGTCAACCTGCTGCAGGAGACCCGCCATGCCTTCGAGAGATGCCACAGGCTTTCGGACCCGTCGGACCTGCCCAAAAATGCCTTCTCAATCTTCTTGCTGCTGGTTGAGCATCTTTGCGTGGAGCACATTGACTACGCCCTGGAGATAGGCCTCTCAGCGATTCCCTCATCAGACGCCAAGAACGCCAATCTGTACTTCCTGGATGTGGTTCAGCAGGCAAACTCAATCTTCCACTTGTTTGACAAACAGTTTCACGACCAGCTAATGCCTCTAATAAGCTCATTGGCCGAGTGCCTGCACAAGAAGAAAGAGGTGATTGAGCAGATGGAAGTGAAGCTGGACACTGGAATTGACAGAACGATAAATTGTATGGTGGGGCAAATGAAGTACATCCTAGCAACAGAGCAGAAAAAGACGGATTTTAAACCTATGATCCAGTACACTACAGCCTGCTCCAAGGTCTGCGTCTACGTCAGTCGGCAGGTGGAGCACGTGCGGAAGTCCATGGATGGCAAAAACGTGGACACGGTGCTGACAGAGCTGGGCGTCCGTTTCCACCTCATCCACGAGCACCTGCAGCAGTACAGTTACAGCTCCATGGGAGCCATCTGTGACGTGGCCGAATACCGACGGTGCGCCAAGGACTTCAGGGTCCCACTGGTGCTGCAGCTCTTTGACACACTCCACGCCCTTTGTAACCTCCTTGTGGTTGCCCCTGACAACCTGAAGCAGGTCTGCTCAGGCGAGCAGCTCACCAATCTGGACCGAAACCTCCTGCACGCTTTCGTCCAGCTCAGAGTGGATTACCGTTCAGCCAGACTGGGCCGCCACTTCAGC
(((((((a0000:0.150779,a0011:0.366606):0.020186,(a0008:0.189257,a0012:0.064304):0.491414):0.003135,(a0005:0.027918,(a0014:0.008119,a0002:0.002763):0.019253):0.07771):0.185033,a0009:0.275464):0.185673,a0003:0.29294):0.394691,a0013:1.474877)#1:0.414072,(((a0006:0.64944,a0001:0.369005):0.077098,(a0004:0.342883,a0010:0.114781):0.128282):0.442747,a0007:3.987982):0.466218);
15 5679
a0010 CTTGTTGATGACAGATGTGTGGTCCAGCCCGATACCGGAGACCTGGCCAACCCGCCTAAAAAGTTCAGAGATTGCCTCTTCAAGGTGTGTCCCATGAGTAGATACTCAGCCCAAAAGCAATTCTGGAAGGCAAAACAGGGGAAACAAGGAAACAACACACAGGGAGACCTGTTTAAGAAGTTACAGCATGCAGCAGAGTTGGAGCAGAAACAGAATGAATCGGAAAACAAGAAGCTGCTGGGTGACGTGGTCAAATACAGCAACGTCATCCAGCTTCTTCACATCAAGAGTAACAAGTTTCTGACTGTCAACAAACGCCTCCCCGCTCTCCTGGAGAAGAACGCCATGCGTGTGTCTTTGGACTCGGCCGGGAATGAAGGTTCCTGGTTCTACATCCAGCCTTTCTGGAAGCTCCGCAGTGAAGGAGATAATGTGGTTGTTGGAGACAAGGTGGTCCTGATGCCAGTGAACGCAGGGCAGCCTCTTCATGCCAGTAACATCGAGCTTCTGGACAACCTGGGCTGCAAAGAGGTCAATGCTGTGAACTGCAACACCAGCTGGAAGGTCACATTGTTCATGAAGTTTAGCGACTACAAGGAAGACATCCTGAAAGGGGGAGACGTTGTGAGGCTGTTTCATGCCGAGCAAGAGAAGTTTCTCACCTGTGACGAGTACAGGAGGCAGCAGCACGTCTTTCTCAGAACCACCTTGCGGCAATCTGCCACTTCTGCCACCAGCTCCAAGGCCCTCTGGGAGGTTGAGGTTGTGCATTATGACCCCTGCAGAGGTGGCGCCGGCCAATGGAACAGCCTCTTCCGCTTCAAACATCTGGCAACTGGGAATTATCTGGCGGCCGAGAATGAGGATGTTGTATTCTCCAAGAGGAAGCATCTGGCAGAGAAGATCACCTTCACCCTGGTTTCTGTTCCCGGGAATGACATCGCCTCGCTCTTTGAACTGGACGCCACCACCTTGCAGAGGGCAGACTGTCTGGTACCCAGAAACTCCTATGTGAGACTACGGCACCTGTGCACCAACACCTGGGTTACGAGCACCAACGTTCCCATCGATGCAGAGGAGGAACGTCCAGTTATGCTGAAGATTGGCACATGTCCCGCGAAAGAGGACAAGGAAGCCTTTGCTATCGTGTCTGTGCCTCTGTCGGAGGTCAGAGACTTGGATTTTGCCAACGATGCCAACAAGGTTTTGGAGTCCACCGTGAGGAAGCTTCAATACGGCACCATCACACAGAATGAGAGGAGGTTCGTGACAAAACTCCTTGAGGATCTGGTCTTCTTTGTGTGTGTGGTGCCAAACAATGGCCAGGACGTTTCTGTGGTCACGTCTATGCCTAACCGAGAGAGACAGAAACTCATGAGGGAGCAGAACATCCTTGCCCAGATCTTTGGTATTCTGAAGGCTCCATTCACAGATCAGGGTGATGGTCCAATACTGAGGCTGGAGGATCTGGGAGACCAGCGCTATGCTCACTTCAAGTACATGCTGAGACTCTGCTACAGGGTCCTGCGCCACTCCCAACAAGACTATCGCAAGAACCAGGCAGCCAAAAAGTTCACGATCATGCAGTCTCAGATCGGGTACGAGATCCTGGCAGAGGATACAATCACTGCGCTGCTGCACAACAACCGCAAGCTGCTGGAAAAACACATCACGGCCAGAGAGATCGAGACTTTTGTCAACCTACTGAGGCGTAACCGAGAGCCCAGATTTCTGGATTATCTCTCTGATCTGTGCGTGTCTAACAAGACTGCAATACCCGTGACACAGGAGCTTATCTGTAAATTTATACTGAACCCCACCAACGCAGACATCCTCATCCAAACCAAGCTGATCTCTAGCACGACCCTGGAGTCCTCTCTGCAGGAGGAGGTGGAGGAAGAGGAGGTATGGCTCTACTGGATTGACAGCCACATCCGCCACCTGGCTCAGGATGCTAAAGGCGATGTAGACATCGTCACCTATTACAGGTACCAGCTAAACCTGTTTGCCAAAATGTGTCTGGACCGCCAATACCTTGCTATCAACCAGATCTCCTGCCAGCTGCCTGTGGATCTAATCCTGCGCTGCATGTTTGATGACTGCCTACCCTACAATCTCCGTGCCTCCTTCTGTCGCCTCATGTTACACATGCACGTGGACCGGGACCCGCAGGAATCTGTAGTGCCGGTTCGATACGCACGCCTCTGGACCGAGATCCCCTCCAAAATCACAGTGCAAGAGTTCGAGGAGTCCACCGACACGTCAACAGAGGAGATGAAGAGGAAGTTCGCACCCACCATGGAATTTGTCGAGGAATATCTCACAGATGTGGTCAGTCAGCCTTTTCCATTTGGGGACAAAGACAAAAACGAACTCACCCTAGAGGTGGTGAATCTGGCTCGTAATCTGGTCTACTTTGGTTTCTATAGTTTCAGCGAGCTTCTCCGTCTCACACGCACTCTCCTGGCAATTCTCGATATTCACCCACTCAGCTTCATTAACAAGCTTAACAAGAGTCCAGAAGCTGGAAACAATGTCCTGCGCACCATCCACGGAGTTGGAGAAATGATGACTCAGATGGTTATGAGTCGAGGAGTGCCACACAGCCTCCCTGACACCCCTCCCTCCCTGCGCTATGGCAAATTGTCTGACAACGAGGACGTAATGGTGATGGACACCAAACTGAAGATCATAGAGATCCTGATTCTGAGTGTGAGGATCACTAGCTCAGAGTTAAGCGCAGTGGAGCTGGATGACCAGGCCTTCCAGCTTCTAGTGTCAGAACAAGACGTGGAGAACTACATCAAGACAGACTTGGATCAGCTGCGTCTGAAGTCAGAAGTCAGAGTCCAGGATGGAGACAACAAGCCTCAAATTGACAGCATCAAAGCAAACAACTATAAAATCGTCAAGGAGATCTTACTCCGGCTCAGTAAGCTGTGTTACCCCAGCAAGAAGAGTCGTGTGCAGAGGCTTCTGAAAAACATGGGGGCCCACACTGTCGTGTTGGACCTGCTGCAAATCCCCTACGAAAAGAGTGATGAAAAGATGAATGAGATCATGACCCTGGCGCACACATTTCTACAGAACTTCTGTAGAGGAAACCCTCAGAACCAATTGCTGCACAAACACCTGAACCTTTTCCTCACCCCAGGGTTGCTGGAAGCGGAGACGATGATCTTCATGAACAACTACCAGCTGTGCAATGAGATCAGCGACCGCGTTGTCCATCACTTTGTCCACTGCATTGAAACACACGGACGACACGTCCAGTACCTCAAGTTCCTGGAAACAATTGTGAAGGCTGATGGAAAGTATGTAAAGAAATGCCAGGACAAAGTCATGACAGAGCTGGTGTTGGTGTTCTACAACGACCGCTCCTCCTTCCCGGTGCTGCTGCAGATGATGGGCTCCGAGCGAGAGACCGATGAGGATGGACTGGCCTATCATAACACCCTGGTGGAGCTGCTGGCTGCCTGCACAGAGGGCTACACCGAGCTGAAATGCAACTCCCTGCTGCCGGATGATATCGTACGAGTCGTCACCGACATCCACTGTGTACCAGAGGTGAAATCTGCTTATGTGAACTTTGTCAATCATTGCTACGTGGACACAGAAGTAGAAATGAAGGAGATCTACACGTCCAACCATATTTGGAAGCTCTTTGACAACTTCTTGGTGGACATGTCCCGTGTGTGCAACACCACCACGGATCGAAACGCCCTGGAGAAATATGTGACAGAGACAGTGATGGCCATAGTCAAGGGTTTCTTCAGCTCGCCTTTCTCTGTCAACCATGCCAACTTGCAGACAAACCAGTCGATCTTCATCAAGCTGCTCCAGTCTTCCTTCAGGATCTATAACTGCACCTGGCTCAGCGCATCTCAGAAGGCCAACATTGAAAGCTGTATTAAAACTCTTGCTGATGTGGCTAAGGCACGGGCCATAGCCATCCCGGTGGACCTGGACAGTCAGGTCAACACTTTGTCCCTCAAAGTCCACACCATGGTGCAGCGAGCCGCCAAAGACTGGAGGATATCTGCGCGCTCACGACCGCGCAAGGAGCCGCTGGGTTGTCCTGACTACCGGAACATCATCGAGAAGCTACAGGGTGTTGTATCCCTTTTGGAGGAGCAGTTCAGTCCAAAAGTTCAGGCCGAGTTTTCTGTTCTGGTGGACGTTCTTCACAGTCCTGAGCTGCTGTTTCCAGAGGCTGCTCAATTATGTGAAAGTGGAGCATTCATGTCTAAACTAATTAAACACACCAAGAAGCTTATGGATAAGAAACTGTGCATCAAAATTTTGCAGACTCTCCGGGAGATGCTCGATAAGAAGGAATGCATCCAGGAGGGGAATGAGCTGAGAAAGCTCACACGCTACTTTAAGTCAGAGACCGGGAGTGGAAACGTGAAGTCATCATCTAGCAGCATGGTGGAGATCCAGTGTCTATTGGACAATGTTGGGACCTCGGAGCTGGTAATTCTTATTGTCAACACCAAGAACGACCGGGTGTTTGAAGAGAGCATCCTGCTGGGCATTGCCCTTCTCCAGGGAGGAAACACACAGATACAGAACTCCTTCTACAACCAACTATCCATGCAGAAGAAGTCAGAGAAGTTTTTCAAGGTCTTCTACGATCGCCTGATCCGAGCCACTGTCTCCGTCAATGAGCTCAGCTGCCGGAAGAGGGACGATGACGGCGACGTCTCCAGTATCAGGTTCAAGAGAGGGAAGGACTCGCTCCATATGAAGGATGACATGCGAGGGCAGCTGAAGGAGGCTTCTTCTGTGACCTCAAAGGCCTTCAGTGCCTTCAGGAAAGAGCTTGATCCAGACCTGGCAGCTGAAGAGGTGTTGGAAGAACCGAAGCTGAGCCCCGCCATCACAATAATGAAACCAATTCTGCGTTTCCTACAGCTGCTCTGTGAGAACCACAACTCAGAATTACAGACTTGTATAGCCAAGCATGAGTCCAATGGCATCGACATCATCATAGCGCTAATTGTCAATCCCATCAATCCCCTGGGGAAGGATCGACTGGATCTGGTGCTGGAGCTAAAGAACAATGCCTCCAAGCTCCTACTGGCCATCATGGAAAGCCGCCATGACAGTGAGAACGCAGAAAAGATTCTCTACAAGATGAGACCCACTGAGCTGGTGGACGTCATGAAAGAGGCGTATACTCAGGTTCTGGAGAGCGAGGAGGACGACAGCGTGGACCAAATCAAGCCCAGAGATGTTGGACACAACATTTACATCCTGGCCCATCAGCTGGCCCGGCACAGTAAGGTTCTGCAGCAGAGCCTCAAGCCAGGATTTGACCCTGACGAGAAGGACGCCGCCTTTCATTACTATGCCAATCACACAGCTCAGATAGAGATCGTGCGTCATGACCGCACCATGGAGCAGATTGTGTTTCCCGTCCCCAACATCTGCGAATACCTGACCGAAGAGTCCAAGGTTCGCGTCTTCACCAGCACCGAGAGGGACGACCAGGGCAGCAAGGTCAATGACTTCTTCCAGCAGTTTCACAACCTCTACAATGAGATGCGGTGGCAGAAGAAGATCCGCAAAAATAAAGCTTTGTTCTGGTTCTCCCGCAATATTTCTCTTTGGGGGAGCATCTCCTTCTACCTGGCCTGTATGGTCAACATCGTGGTGGCTGTCTTTTACCCTTTT
a0004 CTTGTTGATGACAGATGCGTGGTCCAGCCCGATGCTGGAGACCTGGCCAACCCTCCCAAGAAGTTCAGAGATTGCCTCTTCAAGGTGTGTCCCATGAATAGATACTCGGCCCAGAAGCAATTCTGGAAAGCCAAACAGGGAAAACAAGGAAACAACACGCAGGGAGACCTGTTCAAGAAGTTACAGCATGCAGCAGAGTTGGAGCAGAAACAGAATGAATCAGAAAACAAGAAGCTGCTGGGCGAAGTGGTCAAATACAGCAACGTCATCCAGCTGCTTCACATCAAGAGTAACAAGTTTCTGACGGTGAACAAACGTCTCCCTGCGCTCCTGGAGAAGAATGCCATGCGTGTTTCTTTGGACCCGGCCGGGAACGAAGGTTCCTGGTTCTACATCCAGCCTTTCTGGAAGCTCCGCAGCGAAGGAGATAATGTGGTGGTTGGAGACAAGGTGGTCCTGATGCCGGTGAACGCAGGACAGCCTCTCCATGCCAGCAACATCGAGCTTCTGGACAACCCAGGCTGCAAGGAGGTCAACGCCGTCAACTGCAACACCAGTTGGAAGATTACGTTGTTCATGAAGTTTAGTGACTACAAGGAAGATGTCCTGAAAGGGGGAGATGTCGTGAGGCTGTTTCACGCTGAGCAGGAGAAGTTCCTCACCTGTGATGAGCACCGGCGGCAGCAGCATGTCTTTCTCAGGACCACGCTGAGGCAGTCTGCCACCTCTGCCACCAGCTCCAAGGCCCTCTGGGAGGTCGAGGTTGTGCACTATGACCCCTGCAGAGGTGGCGCCGGCCAATGGAACAGCCTCTTCCGCTTCAAACATCTGGCAACGGGGAATTATCTGGCGGCTGAGAATGAGGACGTGGTGTTCTCCAAGAGGAAGCATCAAGCAGAGAAGATCACCTTCACCCTGGTTTCTGTTCCCGGGAACGACATCGCCTCGCTCTTTGAACTAGACGCCACCACCCTGCAGAGGGCAGACTGTCTGGTGCCCAGAAACTCCTATGTGAGACTACGGCACCTCTGCACCAACACCTGGGTTACAAGCACCAACGTTCCCATTGATACGGAGGAGGAACGTCCAGTCATGCTGAAGATTGGCACCTGTCCCGCCAAAGAGGACAAGGAAGCCTTTGCTATTGTGTCGGTGCCCCTGTCGGAGGTCAGAGACTTGGACTTTGCCAACGATGCCAGCAAGGTTTTGGAGTCCACTGTGAGGAAGCTTCAATATGGCACCATCACTCAGAACGAGAGGAGGTTTGTGACGAAACTGCTGGAAGATCTGGTCTTCTTTGTGTGTGTGGTGCCGAACAACGGCCAGGACGTTTCTGTGGTCACTTCCACACCCAACCGAGAGAGACAGAAGCTCATGAGGGAGCAGAACATCCTCGCCCAGATCTTTGGTATCCTCAAGGCTCCGTTCACCGATCAGGGTGATGGTCCAATACTGCGGTTGGAGGATCTGGGGGACCAGCGCTATGCACACTTCAAGTACATGCTGAGACTCTGCTACAGGGTCCTGCGCCACTCCCAGCAGGACTATCGCAAGAACCAGGAAGCCAAAAAGTTTACAATCATGCAGTCTCAGATTGGGTACGAGATCCTGGCTGAGGACACCATCACCGCGCTGCTGCACAACAACCGCAAGCTCCTGGAAAAACACATCACGGCCAGAGAGATCGAGACTTTTGTCAACTTGCTCCGACGTAACCGAGAGCCCAGATTTCTGGATTATCTCTCTGATCTTTGCGTCTCTAACAAGACTGCAATACCTGTGACACAGGAGCTTATCTGTAAATTTATGCTGAACCCCACCAACGCAGACATCCTCATCCAAACCAAGCTAATCGCTAACACGACCCTGGAGTCCTCTCTGCAGGAGGAGGTGGAGGAGGAGGAGGTCTGGCTCTACTGGATTGACAGCCACATCCGCCACCTGGCGCAGGATGCTAAAGGCGATGTAGACATCATCACCTATTACAGGTACCAGCTGAACCTGTTTGCCAAAATGTGTCTGGACCGCCAGTACCTCGCCATCAACCAGGTCTCCTGCCAGCTTCCCGTGGATCTGATCCTGCGCTGCATGTTTGATGACTGCCTGCCCTACAACCTCCGGGCCTCCTTCTGCCGCCTCATGCTGCACATGCACGTGGACCGGGACCCGCAGGAGTCGGTGGTTCCTGTCCGATACGCACGCCTCTGGACCGAGATCCCCTCCAAAATTACAATACACGAGTTCGAGGAGTCCACCGACACCTCAAGAGAGGAGATGAAGAGGAAGTTTGCTCCCACCATGGAATTTGTGGAGGAATACCTCAGAGATGTGGTCAGTCAGCCTTTTCCATTTGGGGACAAAGACAAAAATGAACTCACACTGGAGGTGGTGAATCTGGCTCGTAATCTGGTCTACTTTGGATTCTATAGTTTCAGCGAGCTTCTCCGTCTCACACGCACTCTCCTGGCCATTCTCGATATTCACCCGCTCAGCCTAATAAACAAGCTTAATAAGAGTCCAGAAGCTGGCAACAACGTCCTGCGTACGATCCACGGAGTGGGCGAAATGATGACCCAGATGGTTATGAGCCGAGGGGTGCCGCACAGCCTGACCGACACCCCTCCCTCTCTGCGTTATGGTAAATTCTCTGACAACGAGGACGTGATGGTGATGGACACCAAGCTGAAGATCATTGAGATCCTGATTCTGAGCGTGAGGATCACGAGCTCAGAGCTGAGTGCAGTGGAGCTGGACGATCAGGCCTTCCAGCTTCTAGTGTCGGAACAAGATGTGGAGAACTACATCAAGACAGATTTGGATCAGCTGCGTCTGAAGTCAGAAGTCAGAGTCCAGGATGGAGACAACAAACCTCAAATTGACAGCAACAAAGCAAACAACTATAAAATAGTCAAAGAGATCCTACTTCGGCTCAGTAAGCTGTGTTATCCCAGTAAGAAGAGTCGTGTGCAGAGGCTGCTGAAAAACATGGGGGCCCACACTGTGGTGTTGGACCTGCTGCAGATCCCCTACGAGAAGAGTGATGAGAAGATGAATGAGATCATGACCCTGGCACATACGTTTCTCCAGAACTTCTGTAGAGGAAACCCTCAAAACCAACTGCTGCACAAACACCTGAACCTTTTTCTCACTCCAGGGCTGCTGGAGGCGGAGACGATGATCTTCATGAACAACTACCAGCTTTGCAATGAGATCAGCGACCGCGTGGTCCATCACTTCGTCCACTGCATCGAAACACACGGAAAACATGTGCAGTACCTCAAGTTCCTGGAAACCATTGTTAAGGCGGATGGAAAGTATGTGAAGAAATGCCAGGACAAAGTCATGACAGAGCTGGTGTTGGTGTTCTACAACGACCGCTCCTCCTTCCCAGTGCTGCTGCAGATGATGGGCTCTGAGCGCGAGACGGATGAGGACGGACTGGCCTATCACAACACCCTGGTGGAGCTGCTGGCTGCCTGCACCGAGGGCTACACTGAGCTGAAATGCAACTCTCTGCTGCCGGATGACATCGTCCGAGTGGTCACCGACATCCACTGTGTACCAGAGGTGAAAACTGCTTATGTGAACTTTGTCAATCACTGCTACGTGGACACAGAGGTAGAAATGAAGGAGATCTACACCTCCAACCATATCTGGAAGCTCTTTGACAACTTCCTGGTGGACATGTCCAGTGCGTGCAACACCACCACAGAGCGTAACGCCCTGGAAAAATACGTGACGGAGACCGTGATGGCCATTGTCAAGGGTTTCTTCAGCTCGCCTTTCTCCGTTAACCACGCCAACTTGCAGACAAACCAGTCCATCTTCATCAAGCTGCTCCAGTCTTCCTTCAGGATCTATAACTGCACCTGGCTCAGCGCTCCTCAGAAGGCCAACATCGAGAGCTGTATTAAAACCCTCGCTGATGTGGCTAAGGCACGGGCCATAGCCATCCCAGTGGACCTGGACAGTCAGGTCAACACTCTGTCACTCAAAGTCCACACCATGGTGCAGCGGGCCGCCAAAGACTGGAGGACATCTGCACGCTCCCGACCACGCAAGGAGCCACTGGGTGGGCCTGACTACAGGAACATCATCGAGAAGCTACAGGGTGTTGTCTCCCTCCTGGAGGAGCAGTTCAGTCCCAAAGTTCAGGCGGAGTTCTCTGTTCTTGTGGACGTTCTTCACAGTCCTGAGCTGCTGTTTCCAGAAGCTGCTCAGTTATGTGAAAGTGGAGCATTTATGTCCAAGCTAATTAAACACACCAAGAAGCTCATGGATAAAAAGCTGTGCATCAAAATTTTACAGACTCTTCGTGAGATGCTCGACGAGAAGAAATGCATCCAGGAGTCTAGCTGTCGGAGGAGATTAAAGAAGCACACTTGGATGCGAATAATCAACGGGAATATTTCCCCAAAGGACTGCCCCCTGACCAGCCTGCATTGCTGTTGGGCTGATAAGAACTTTAGTTGTGTTCTCATATTCTACCAGGCCTTTCTGGATACAGCCATGCTTTCAGCAGGTTTCTTTTTGTTTTTCCTGTCAGGGCAGCCGGGCATTAGCCAGCAGACTGCATCATGCAGCAGGCAGACGAGTGAGGGCGAACGTCCGAGAGCCCCTTTTAAACTTTTCTTTAGTCGATGTCTCAGGGCAGAGCTCATTCTGCACAACCTGGGAAAGAAAAGGGGAAACGTTGAGTCAAACATGGTTCTGTTTGGAATCAGTCAGAGGAAAGAATCGCTCCATATGAGGGATGACATGCGGGGGCAGCTAAAAGAGGCTTCCTCTGTGACCTCAAAGGCCTTCAGTGCCTTCAGGAAAGAGCTGGATCCGGATCTGGCAGCTGAAGAGGGGCTGGAGGAAACGAACATGAGCCCAGCCATCGCAATCATGAAACCAATTCTGCGTTTCCTACAGCTGCTCTGTGAGAACCACAACTCAGAATTACAGACTTGCATAGCCAAGCATGAGTCCAATGGCATCGACATCATTATAGCGCTAATTGTCAACCCCATCAATCCCCTGGGGAAGAATCGGCTGGATCTGGTGCTGGAGCTTAAGAACAATGCCTCCAAGCTCCTACTGGCCATCATGGAAAGTCGCCACGACAGTGAGAACGCGGAGAAGATTCTCTACAAGATGAGACCCAATGAACTGGTGGACGTCATGAAGGAGGCATACACTCAGGGTCTGCAGAGCGAGGAGGACGACGGCGTCGACCAGATCAAGCCCAGAGATGTAGGACACAACATTTACATCCTGGCCCACCAGCTGGCGCGGCACAGTAAGGTTCTGCAGCAGAGCCTCAAGCCCGGATTTGACCCTGACGAGAAGGATGACGCCCTTCATTACTATGCCAATCACACGGCTCAGATAGAGATCGTACGTCGTGACCGCACCATGGAGCAGATTGTGTTCCCTGTCCCCAACATCTGCGAGTACCTGACCGAGGAGTCCATGGTTCGCGTCTTCACCACCACCGAGAGGGACGACCAGGGCAGCAAGGTCAATGACTTCTTCCAGCAGTTTGACAACCTCTACAACGAGATGCGTTGGCAGAAGAAGATCCGCAGTAATATAGCTCTCTTCTGGTTCTCACGGAACATCTCCCTTTGGGGGAGCATCTCCTTCTACCTGGCCTGTCTAGTCAACATCGCTGTGGCTGTCTTTTACCCTTTT
a0007 TTGGTGGATGATAGATGTGTAGTGCAACCTGAGACTGGGGATCTTACAAACCCACCGAAGAAATTCAGAGATTGTCTCTTCAAAGTGTGTCCTATGAATCGATACTCTGCACAGAGACAGTTCTGGAAGGCCAAACAGGGCAAGCATGGGAACAACACACAGGCTGATCTCTTCAAGAAATTACAGCATGCAGCAGAACTGGAGCAGAAACAAAATGATTCAGAGAACAAGAAACTGCTGGGTGAGGTTGTCAAATACAGTCGGGTTATACAGCTTCTCCATATTAAGAGTAATAAGTATTTGACGGTGAACAAGCGTCTGCCGGCGCTGCTAGAGAAGAATGCTATGCGTGTATCTCTGGACCCTTCGGGAAACGAGGGCTCTTGGTTCTACATCCAACCTTTCTGGAAGCTGCGCAGTGAAGGAGACAATGTAGTGGTTGGAGATAAAGTGGTCCTCATGCCTGTAAATGCAGGACAGCCTCTCCATGCCAGCAACATTGAACTCCTGGACAACAGAGGCTGCAAAGAGGTAAATGCTTTGAACTGCAATACTAGCTGGAAGGTGACGCTCTTCATGAAGTTCAGTGAATACAGAGATGATATTTTAAAAGGGGGGGATGTGGTGAGATTGTTTCACGCCGAGCAAGAAAAGTTTCTCACTTGTGATGAGTACAAGAAGCAGCAGTATGTGTTCTTGCGCACCACGCTCCGCCAGTCTGCAACCTCTGCCACCAGTTCAAAAGCACTCTGGGAAGTAGAGGTTGTCCACTATGACCCGTGTCGAGGAGGCGCTGGCCAGTGGAACAGCCTGTTTCGATTTAAACACCTCGCCACAGGTCACTACCTTGCAGCAGAGACCAACGAGTCTTTGTACTCTAAAAAGAAGTGGCAGGCTGACAAGATCCCCTACACACTGGTTGCAGTGCCCGGCAATGACATCGCATCTCTCTTTGAACTGGATGCCACCACCTTACAGCGGGCAGACTGCCTGGTCCCCAGGAACTCGTATGTGAGACTGAGGAACTTGTGCACAAATACTTGGGTGACCAGTACTAACATTCCCATTGATGTTGAGGAGGAGCGACCCGTTATGCTTAAGATCGGCACCTGCCACATGAAGGAGGACAAGGAGGCATTCTCCATTAATTCTGTCCCCCTCTCTGAGGTCCGAGACTTGGACTTTGCCAATGATGCCAACAAGGTTCTGGAGTCATTTGTACGTATATTGGGGATCAGCAACGCGGCTGCAAATGAACGCAGGTTTACTATTAAGCTGTTGGAGGATCTGATCTTCTTTGTGGGTGATGTGCCAAACAATGGACAGGATGTTTCCGTAGTCATATCGAACCCCAACAGAGAGAGACAGAAACTCATGAGAGAGCAAAACATCCTGGCACAGATCTTTGGGATTCTGAAAGCCCCATTTTCTGAGATCAAAGACTCGCCCATGCCGAAGCTGGAAGATGTGGGGGAGCAGCGCAACTCTGCATTTAAGTACATGCTACAGTTGTGCTACAGAACCCTCCGCCATTCACAACAAGACTACCGAAAGAATCAGGAGGCCAAGAACTTCTCAATCATGCAGGCTCAGATTGGCTATGAAATCTTGGCTGAAGACACGATCACTGCTCTCCTGCACAACAACCGAAAGCTGTTAGAGAAGCACATCACAGCACGTGAGATCGAGACATTTGTCAAGCTTCTGCGCAGGAACCGTGAGCCCAGGTTTCTGGATTACTTGTCTGACCTGTGCGTGTCCAACAAAACTGCCATTCCCGTCACTCAGGAGCTGATTTGCAAGTTTATGCTAAACCCCACAAATGCGGACATCCTCATTCAGACCAAACTGATCCAGCACACATCTCTGGAGTCATCTCTCCATGATGATGTTGAGGATGAAGAGGTGTGGCTGTACTGGATTGACCACCACATTCGCCACCTGGCACAGGATGCCAAGGATGACACGGACATCATCACCTATTACAGGTGTCAACTCAATCTCTTTGCTAAAATGTGCCTGGACCGGCAGTATCTGGCCATCAATCAGATTTCCATTCCGCTACCAGTAGATCTAATCCTGCGATGCATGTTTGATGACTGCCTGCCTTACAACCTGCGTGCCTCTTTTTGTCGTCTAATGCTGCACATGCACGTGGACCGTGACCCGCAGGAGGCCGTGGTGCCTGTTCGTTATGCACGTCTCTGGACCGAAATACCCTCCAAGATCTCTGTCAACGAGTATGACGAGTTCAGAGACACGTCCAGAGAGGAGATGAAGAGAAAGTTTGCACCTACTATGCATTTTGTAGACGAATATCTCAAAGATGTGGTCAGTCAGCCTGATCCATTTGGAGACAGAGAGAAGAATGAACTGACCCTTGAGGTGAGAGACGTTTGGTTTAGTTTGGTTTGTTTAGACAAAGATGAGGAATCTGACATTATACTGAATGAGAAAATTGTTTTATTTATGTTGGAGATAGCACCCTTGACTTTTATTTTCAATTTGAAGACAAAAGCAGAAGAGGGAAGCTCTGTGGTTGTCAGTCTTCCTGGATTGGATGTTTCCCCTGGAGATTTGTTTGTGTCCAATGGTGCACCTCTATTTTCAGTTGGTCTGAAACCGAGTCACACTATCCATAAAGTCCCTCAACTAGAAAAACTTTCATTAAATAAATTTAAATGCAAAGTCGTCATATATATCACAGTAAATGTGCACATCTTACAGAGTGATGCTGAAGTCCCCGAATGGAGAGACTATGCATATTTATATTTGTTTTACTCAAAACACACACACTCATTCATAGAGAATAAGCACAACGAATTTTATTTTAGAAATATTCTTTCTGAGCAAACAGAAACACAAATGCCACCGTTGAAACCCTACCGCGAATCCCGTCACACAATTGTTAAGGACATTTATTATTACTTGTCACATATAAGCTATTTCATTCACAAAATATTCATGTCAAAAATCAAAGATGTCCTAAACAACAGCAAAACCCATCTGGTAATACTTAAAACCCCATTTGAGCAAAATGAGCCGACTATTCAAAAAAAAGTGCGAATGAGCCATCAACTCAGTCAAAATGTTTTACAACCTTCCTCTCAAGCATCATTGCTGAATAAAAATTTTGATTTCTTAATAAATCATGAGCTTTTACAAATTATATTAATGATATATTTAAACTCTTTTGTGCTTAAAACCAGAAAAAGTAATAGGCTTTTGTTAAATGCACTGCATTGTTACCTTGCACATTATGTCCATGTCAAAATGGTCAACTTTCTTCAGCAAAAAAAAAAAATGCAAACACTCTTTTTGCTGTATGCTCGGTCTGAAAGCAAGGCCCGAATGCCCTTACAATTTGTCTTGGCCCCGCTTGCGAATCAACAATCTCTCCAATTGCTCTCACATGCAAGGGATCTGGATGAAGATGGATTGCTCTACGTTGTAACGTTGATTTCAAGAACAAGTTCATGTACAGATTATTTTTATAAAGTTGTCTGTTCAGCAAGGCTTGATTTTGATCAAACCAGATCTATATTTCATATATACTGTATATACAATACTTATATTCAATTTTGTAATGGTCAAAACCACTGCAAATTGCACTATGAAATATTATTTAATTATATAAGGACTCGTTGCCACCTTTGGAAAATGTTGGTGTCATTTATAATTGACAGGTCTAAACCACAACAAAACGCGCTATGCAAAAATATTATTGAAAAATATGAGCAGCAGGTTTTTTTGCATGTGGTTGCAGTTTTCTGGGTTGGTAGATGCAGCGGGGACTTGACACCACTTAAACACAGAAAAAGTCTTTTCCTGAAGTTGATAAAAGTAGTTTTTACTTTATTTAATATAAAGCTGCTTTACCTTCTCGAACGTTTTCATACAAACAACATTCAAGTCACTTCTAATACTAATAAGCAGCACAAGCCGAGAGTCACACCTGTTGATCGCCAATCTCAAACCCCAACCTTATTAATGCAGACTTTCAATCTGAAAAACAACACTGAAAATAGCTTCAGCAAACCCCAGACAGATGTAGAAAAGGAGAACGAGGCAGACAGACTACATTATTTGAATGTATTTCCTAACACAAACACAATTGCTAATATATTTCTTATGGTATTAAAAAAGACTGTTGAGTGCATGTTAAGCTATCTTATTATGCTTAGGTTTGCACTTGAGCTTTTAAATCCACAAATGAAAGATTGCAGTGACTCAGATGTACACTTTTTTTTCCTATTGAATTTTTTAAAAAATATTAGGAAAAATCAATTATGTTTGGTCACTTTTGTATCATTAATTATGTTTATGAATAATATACAGGGTCTTTTAAAAGGCAATGCACTGAGGAAGCTTGCTCACTACTTCGCCCTGGAGTACAGCAGCAGCAACACTAGAACTCCATCAACAAGCTTAGCAGATATCCAGTGTGTGCTGGACAATGTCGGAGCTTCCGAGCTGGTCGTCCTCATAGTCAGCACTAAAAATGACCGGATCTTTGAGGAGAGCATTTTACTGGGCATCGCACTGCTGAGAGGAGGGAATACACAAATTCAGAACTCATTTCACAATCAATTGCACAAGCAGAAGAAGTCTGAGAAGTTCTTCAGGGTCTTCTATGAGCGCATGATCCGTTCCAGCGTCTCTGTCAACGAGCTCAGCTGCAGGAAGAGGGAGGAGGAGAGCGAGGGCTCCGGGATCAGACATAAGAAAGTAAAAATTCCTCATGAGGTCATAGAAGAGATGCGGGGTCAGCTTAAAGACGCCTCCTCTGTGACCTCCAAAGCCTACAGCACCTTTCGCCGGGAATGGGACCCTGACATTGCGACAGAGGAAGTGGTCGAGGAAATCCAAATGAGCCAGGCCATCACCATCATGAAGCCCATCTTACGCTTCCTTCAGCTGCTCTGTGAAAATCACAACAGAGACCTTCAGTCATGCATAGCCAGGCATGAGTCAAACGGCATTGACATCATCATCGCACTCATTGTGAATCCAATTGATCCACTGGGAAAGAACCGGCTTGACCTTGTGCTGGAACTGAAGAACAATGCATCTAAACTTCTCCTGGCCATCATGGAGAGCCGTCAAGACAGTGAGAATGCAGAAAAGATCTTGTACAAGATGAGACCCAATGAACTGGTTGATGTGATAAAGGAGGCTTATGTTCAGGGAGAAGAATGTGAAATTGACGAGACTTTGGATTTGATCAGATCTAAAGATGTTGGCCATAACATCTACATCCTGGCCCATCAGTTGGCAAAACACAGAAAAAACCTCCAGCAGAGTCTGAAACCTGGCCCAGACCCCACCGATGGAGAAGCAGCGCTCACATACTACACCAACCACACTGCACAGATAGAGATTGTTCGCCATGATCGCACCATGGAGCAGATCGTGTTCCCTGTGCCCAACATCTGCGAGTATTTGACGGAGGAGTCGAAAGTACGTGTTTTCACCACCACAGAGCGGGACGACCAGGGCAGCAAAGTCAATGACTTCTTCCAGCAGTTTGATGATCTCTACAATGAGATGAGGTGGCAGAAGAAGATACGAAATAATGCACCTCTTTTTTGGGTGTCAAAACATATTTCTTTGTGGGGAAGTATTTCCTTTAACATGGCTGTGTTGATCAACTTGGCTGTGGCTCTTTTCTACCCATTT
a0013 TTGGTCGATGATCGCTGCGTGGTGCACCCCGATGCCGGCGACCTGGCCAATCCGCCCAAGAAATTCCGAGACTGTCTCTTTAAGGTCTGTCCCATGAACCGATATTCGGCGCAGAAGCAGTTCTGGAAGGCCAAACAGGCCAAACAGGGGAACAACACCGAGGCCGCGCTGCTCAAAAAGCTGCAGCACGCGGCGGAACTGGAACAGAAACAAAATGAGTCTGAAAACCGGAAGCTTTTGGGGGAAATAGTGAAATACAGTAACGTTATACAGTTACTGCACATAAAGAGCAACAAATACCTCACAGTCAACAAGAGACTCCCCGCGCTGCTCGAGAAGAACGCCATGCGCGTCTCGCTGGATTGCGCCGGGAACGAGGGGTCTTGGTTCTATATCCAACCCTTCTGGAAGCTCCGGAGCGAAGGCGACAATGTTGTGGTGGGGGACAAGGTGGTGCTGATGCCAGTGAATGCCGGGCAGCCCCTCCATGCCAGTAACATTGAGCTGCTGGACAACCCCGGCTGTAAGGAGGTTAATGCTGTGAACTGTAACACCAGCTGGAAAGTGAATCTGTTCATGAAATTCAGTGACTACAGGGACGATGTCCTCAAGGGGGGGGACGTTGTCCGGCTCTTTCACGCAGAACAAGAGAAGTTCCTGACATGCGACGAGTACGAGAAGAAGCAGCACATTTTCCTGCGCACGACTCTGCGCCAATCGGCCACTTCCGCCACCAGCTCCAAAGCATTATGGGAAGTCGAGGTTGTGCACCATGATCCGTGTCGGGGCGGAGCCGGGCAGTGGAACAGCCTCTTCCGCTTTAAGCATCTGGCGACCGGGAACTACTTGGCCGCAGAGCGAGAGGAACTGCCGGTGCACAAGAGGAAATGGCAGGCGGAGAAGATCATGTACACCCTCGTGTCTGTGCCCGGAAATGATATCGCTTCCCTCTTCGAACTGGATGCCACCACCCTGCAGAGAGCGGACTGTCTGGTACCCAGGAACTCGTACGTGCGACTGCGGCACCTTTGCACCAATACGTGGGTGACCAGTACCAGTATTCCCATCGACACAGAGGAGGAGCGGCCGGTGATGCTGAAGATCGGAACGTGCCAGACGAAGGAGGACAAGGAGGCCTTTGCCATTATTTCCGTTCCACTCTCAGAAGTCCGAGACCTCGATTTCGCTAATGACGCCAACAAAGTTTTGGCTTCGACGGTGAAGAAACTGGAATACGGGACCATCACGCAGAACGAGCGGCGGTTCGTTACCAAACTGCTGGAGGACCTGATATTCTTCGTCGCCGGCGTCGCCAACAACGGGCAGGAGGTTGACGTGGTGGTCACCAAACCCAACCGGGAAAGACAGAAGTTAATGAGGGAGCAAAATATTCTGGCCCAGATCTTTGGGATCCTGAAGGCTCCGTTCAAGGACAAAGGCGAGGGGTCCATGTTGCGGCTGGAGGATCTGGGGGACCAACGTTACGCCCCCTATAAGTACATCCTGCGCCTGTGCTACCGGGTCCTGAGACACTCGCAGCAGGACTACCGCAAGAACCAGGAAGCCAAGCATTTCTGCGTCATGCAGTCGCAGATCGGATACGATATTCTGGCGGAAGACACCATCACGGCGCTGCTGCACAACAACCGCAAGCTCCTGGAGAAACACATCACCGCCAAGGAAATCGAGACCTTCGTCAACTTGCTGAGACGGAACCGAGAGCCGAGATTCCTGGACTACCTTTCCGACCTGTGCGTGTCCAACACGACCGCCATCCCTGTCACTCAGGAGCTCATCTGCAAGTTCATGCTGAGCCCGGGAAATGCGGACATTCTCATTCAGACCAAGTTGGTTTCCCAGATGCCTTTAGAGTGCTCGCTACAAGACGACATGGATGAAGAAGAGGTTTGGTTGTATTGGATCGACAGCAACATAAGGCACCTGGCGCAGGAGGCCAAGGAAGATCTGGAAGTCTTGACTTATTATAGGTACCAGCTGAACCTCTTTGCCAGAATGTGTCTGGACCGCCAGTACCTCGCCATCAACCAGATTTCCACCCAGCTCTCGGTGGATCTGATCCTCCGCTGCATGTCCGACGAGAGCCTTCCTTTCGACCTGAGGGCTTCTTTCTGCCGCCTTATGCTCCACATACACGTCGACCGGGACCCCCAGGAAACCGTTGTTCCGGTCAAATACGCCAGGCTGTGGACCGAGATTCCCACCAAGATCAGCATCCACGACTACGACTCCTTCACAGACTCGTCCAGGGACGAAATGAAGAGGAAATTTGCCCTCACCATGGAGTTTGTAGAGGAATACCTCAAGGAAGTGGTCAACCAACCTTTCCCGTTCGGGGATAAGGAGAAGAATAAACTCACCTTTGAGGTGGTCCATCTGGCTCGGAACCTCATTTATTTTGGGTTCTACAGTTTCACTGAGCTCCTCCGACTGACCCGGACCCTGCTGGCCATACTGGATATAAGCCCCATGTCCTACCTGGAGAGACTCAGCAGATTCCAAGATGGAGGTAACAACGTGATGAGGACCATACATGGGGTGGGGGAGATGATGACCCAGATGGTGCTCAGTCGCGGCCTGCCCATTGCGATCCCCGATGTCCCGGCCGGGCTGCACTCCAGCAAAGCCATCGATAACGAGGACATTACGGTCATGGACACGAAGCTGAAAATCATTGAGATCCTAGTGAGAAGGGATAGGGTTAGGGATAGGGATAGGGATAGGGTTAGGGTTAGGGATAGGGTTAGGAGGGTTAGGGTTAGGGATAGGGATAGGGTTAGGGTTAGGGTTAGGGATAGGGATAGGGTTAGGGTTGTTAGGGATGTTAGGGTTAGGGACGGGATAAAGAAGCCTCAGATTGACAGCAATAAAGCGAATAATTACAAGATCGTCAGGGAGATACTGATCCGACTGAGCCGCCTCTGTACTCAGAGCAAGAAGGGTCGGAACCAGAGACTGTTAAAAAACATGGGGGCCCATTCTGTGGTGCTGGATCTCCTGCAGATACCCTATGAGAAGACGGATGACAAGATGAATGACATTATGACTCTGGCTCACACCTTCCTACAAAACTTCTGTCGGGGGAACCCACAAAACCAGCTTCTGCATAAAAAGCTCAATCTGTTCTTAACCCCCGGGCTGCTGGAGGCGGAGACAATGATCTTCATGAATAATTATCATCTGTGCAACGAGATCAGCGACCGCGTCGTGCAGCACTTTGTCCACTGTGTGGAGACGCACGGCCGCCATGTTGAGTATCTGCGCTTCCTGCAAACCATCGTCAAGGCTGATGGGAAATACGTGAAAAAGTGCCAGGACGTTGTTATGACTGAGGTGAGTTATTGTTTCTACTTGCTGTCACATGGGTACCAGGAAATACACTCCCCCATACACAGGAACCAACCCATTACTGGGTACCCACCACATTACTGGGTACCCACCCCCACATTATTGGGTATTCACTCCCCAAGGCTTAGCCGACTCCCCTGTAATTTTGTCGTTCCTACTGAACTTCTATGGCTGATTGTAATCTCCCTGGCAGTGCCAAGCGTTAAAATCGCCTACGTCAACTTTGTCAACCACTGCTACGTGGATACCGAGGTAGAGATGAAGGAGATTTATACCAGTAACCACATCTGGAAACTCTTTGAGAACTTCCTAGTAGACATGGCCCGGGTGTGCAACACGACCACGGACAGAAAGGCGCTGGAGAAGTACGTGACGGAATCTGTGATGAACATTGTTAGCGGCTTCTTCAACTCCCCGTTTTCTGACAACAGCACCAACCTGCAGACGCATCAACCAGTTTTCATCCAACTTCTCCAATCAGCGTTCAGGATTTATAACTGTACGTGGCCCAACCAGACCCAGAAAGCCTCGGTGGAATCCTGTATAAAAACACTGGCAGAAGTTGCAAAGAATCGAGGAATGGCTATTCCCGTAGACCTGGACAGTCAAGTAAACACACTCTTCTTGAAGGCCCATAACATGGTGCAGAGAGCAGCCATGGGCTGGAGGATCACTGCTCGCAACGGGCCCAAAAAAGAGGCACTGGGAAGTCCAGACTACAAGACCATCATTGAGAAGCTTCAGGATGTTGTGGCTTCTCTAGAGAACCAGTTCAGTCCAATGTTACTGGCTGAGTTTTCGGTTCTGGTAGACGTTCTGCACAGTCCTGAGCGCCTGTTTCCCGATGGCAGTGATGCAATTCGCTGTGGGGCCTTTATGTCCAAGCTGATCAACCACACGAAGAAACTGATGGAAAAAAAACTCTGTATGAAGATTCTGCAGACGTTGCGGGAGATGCTGGACAAGAAGGAAAGTTTTGGGGAGGGCTCCACTCTTCGTAAATTGAATCGATATTTCAAAGGAGAACATGGATCGTCTAATGGAAAATCAGTTCCGGTGTCCATATCGGAAATTCAGTGTCTTCTGGACAAAGAGGGGGCGTCGGAGCTGGTTATCGTCATTGTGAGCACCAAGAACGACCGGATATTCTCAGAGGGCATCTTGTTGGGCATCGCGCTGCTCGAGGGCGGGAATACGCAAATCCAGAATTCTTTCTATAAGCAGCTGGATATGCAGAAAAAATCGGAGAAATTCTTTAAGGTCCTTTACGATCGCATGATCCGCGCAACCGTGTCCGTCAATGACTTGGGCACCAAGAAAAAGGAGGAGGATTACGACTCCCTGTCCCTTCCCAAAAGGAGAGGTAACGTATCAATATCAGGTACATTGGGGGGGGGCTGCAGGATCTCGGTGCTGGGAATGGGGGTCACTGAAACTAAAATGTTGTATTCCTTTCCCCTCCAGACTTGCATTGCAACCCATGAGAATGGGATCGATATAATCATTGCCCTGATTCTGAACGACATCAACCCACTTGGGAACAGCCCCCGCTGTATCTGTATCTCATTTCTCTTTCCGTTTCAGACTTGCATTGCAACCCATGAGTCCAATGGGATCGATATAATCATTGCCCTGATTCTGAACGACATCAACCCACTTGGGAAATACCGTATGGACCTGGTCCTGCAGCTAAAGAACAATGCCTCCAAGCTTCTCCTGGCAATCATGGAAAGCCGCCATGACAGCGAGAACGCAGAGAGGATCCTGTACAACATGAGGCCCGCAGAACTGGTTGATGTCATAAAAACTGCCTTCAACCAAGGACTGGAAGGGGATAATGAAGAACATGGAGATCAAGTGTCGCCCAAGGCCGTGGGGCATAATATTTATATCCTGGCACATCAGCTGGCGCGGCACAATAAGGCTCTGCAGCACATGTTAAAGCCGGGACTGGATCCTGAAGAAGGAGACGAGGCACTGAAATACTACGCCAATCATACGGCCCAGATAGAGATTGTCCGCCATGACCGGACCATGGAGCAGATTGTGTTCCCAGTGCCCAATATCTGTGAGTTTCTGACTAAGGAATCTATGTGGCGGGTATTTAACTACACAGAGCGAGATGAACAGGGCAGCAAAGTGAACCACTTTTTCCAGCAGACAGAAGATCTGTACAATGAAATGAAATGGCAGAAGAAAATCAGAAATAACCCGGCCCTGTTCTGGTTCTCCCGCCACATCTCACTGTGGGGCAGCATTTCCTTCAACCTCGCCGTCTTCATCAACCTGGCGGTGGCGCTGTTCTATCCCTTT
a0003 TTAGTGGATGACAGATGTGTGGTTCAGCCGGATGCAGGTGACCTTGCCAACCCTCCCAAGAAGTTCAGAGACTGCCTTTTCAAGGTGTGTCCTATGAACCGGTATTCAGCCCAGAAGCAGTACTGGAAAGCCAAACAAGCCAAACAAGGAAACCATACAGAAGCAGCACTGCTGAAGAAACTTCAACACGCAGCAGAACTGGAACAAAAGCAGAATGAAAGCGAGAACAGAAAGCTGTTGGGCGAAATTGTAAAATACAGCAATGTCATACAGCTACTGCACATAAAAAGTAACAAGTACCTCACAGTTAATAAGAGATTACCAGCTCTGCTAGAGAAGAATGCTATGCGAGTGTCTTTGGATGCTGCAGGGAATGAGGGATCATGGTTTTATATACAACCATTCTGGAAACTAAGGAGCGAAGGTGACAATGTTGTTGTTGGAGATAAAGTTGTACTGATGCCAGTCAATGCAGGGCAGCCACTGCATGCTAGCAACATTGAACTTCTAGATAACCCTGGCTGCAAAGAGGTTAATGCTGTCAACTGTAACACAAGCTGGAAGATAACTTTGTTCATGAAATTCAGTAGTTACCGAGATGATGTACTGAAAGGAGGAGATGTTGTTAGGTTGTTTCATGCAGAGCAAGAGAAGTTTCTGACCTGTGACGAGTATGAGAAGAAACAGCATATTTTCCTTCGTACTACGTTGCGTCAGTCAGCCACCTCTGCAACAAGTTCTAAGGCACTGTGGGAGATAGAGGTTGTCCATCATGATCCTTGCCGGGGAGGGGCAGGACAGTGGAATAGCTTGTTTAGATTTAAGCACTTGGCAACTGGAAACTACTTAGCTGCAGAGAGAGATGACCTTCCTGCTTCAAAGAAGAAACGCCAGGCAGAGAAGATTATGTATACTTTGGTCTCTGTGCCAGGAAATGACATCGCGTCTCTCTTTGAACTGGATGCCACCACTCTTCAGAGAGCTGATTGCCTGGTTCCAAGGAACTCCTATGTCCGACTGAGGCATTTATGCACCAACACTTGGGTTACGAGTACTAGCATCCCAATAGACACCAATGAAGAAAGGCCTGTAATGTTAAAGATCGGGACGTGCCAAACAAAAGAGGACAAGGAGGCTTTTGCCATTGTATCAGTTCCTCTGTCTGAGGTCAGAGACTTGGACTTTGCCAATGATGCGAACAAAGTCTTAGCATCAACTGTTAAAAAGCTGGAGAATGGAACAATAACCCAGAATGAAAGGAGATTTGTGACCAAGTTACTAGAAGATCTGATTTTCTTTGTGTCTGATGTGCCTAACAATGGGCAGGAAGTTGATGTGGTCATTACTAAGCCAAACCGGGAACGACAAAAATTAATGCGGGAACAAAATATTTTGGCTCAGATATTCGGGATCCTCAAAGCTCCTTTTAAGGACAAAGGTGAAGGATCAATGCTGAGACTTGAAGACCTAGGTGACCAGAGATATGCCCCATACAAATACATGTTAAGGTTGTGTTACAGAGTTCTCAGACATTCCCAGCAGGACTATAGGAAGAACCAGGAAGCTAAGAACTTCTGCGTCATGCAGTCCCAGATTGGTTATGATATTTTGGCAGAAGACACCATCACCGCTTTGCTGCACAACAACAGAAAACTGCTAGAGAAACACATCACGGCTAAAGAAATAGAGACCTTTGTTAATTTACTCAGGAGAAATCGAGAACCAAGGTTCCTGGATTATTTATCAGACCTGTGTGTATCTAACACCACAGCAATACCAGTAACACAGGAACTCATCTGCAAGTTTATGCTGAGCCCAGGAAATGCTGACATTCTCATTCAGACAAAGCTAATTTCACAAATGCCCTTAGAATGCCCAATCTCAGATGACATTGATGAAGAGGAAGTGTGGCTTTACTGGATTGACAGTAACATCAGACACCTGGCTCAGGAGGCAAAGGAGGATTTAGAAGTTCTTACCTACTACAGGTACCAACTGAACCTCTTTGCAAGAATGTGCCTGGACCGCCAGTATCTAGCCATCAACCAGATTTCTGCACAGCTATCAGTAGACTTGATCCTGCGATGCATGTCTGATGAAAGCCTACCTTATGACCTCCGGGCTTCTTTTTGCCGGTTGATGCTACACATGCACGTGGACAGAGATCCTCAGGAGTCAGTGGTACCTGTCAGATACGCCAGATTGTGGACTGAAATTCCTACCAAGATCACAATTCATGAGTATGACTCTTTCACAGATTCTTCAAGAAATGAAATGAAGAGGAAATTTGCACTAACTATGGAATTTGTGGAAGAGTACTTGAAAGAAGTTGTAAATCAGCCTTTTCCTTTTGGTGACAAAGAGAAAAATAAACTTACATTTGAGGTGGTACATCTAGCTCGAAATCTCATATACTTTGGCTTTTATAGTTTTAGTGAGCTTCTCAGACTCACCCGGACACTTCTGGCAATTCTAGATATTGTTCCTATGTCATACTTTGAAAGGTTAAGCAAGTTTCAGGATGGAGGAAACAATGTTATGAGAACCATCCATGGTGTTGGAGAGATGATGACCCAAATGGTACTAAGCAGAGGATTTCCCATCAGTGTCCCTGATGTACAGCCAAGCATTCACCCAAGCAAGACCTCAGAGAATGAAGATGTGATTGTAATGGACACCAAATTGAAAATCATTGAGATTTTAATTCTCAGTGTTAGAATATCCAGAAAAGAAAAGAATGCGGTTCAGCTTGATGATCAAGCATTTCAGTTGCTGGTGTCTAATCAAGATGTTGATAACTACATCAAGGCTGATCTTGATCAACTGCGTCTGAAATCTGAAACCAAAATACAGGATGGAACCAAAAAACCCCAGATAGACAGCAATAAAAGCAATAACTACAACATTGTTAAAGAGATTTTGGTTCGACTCAGCAAACTTTGTGTTCAAAACAAAAAGTGTCGAAATCAGCGATTGCTGAAGAATATGGGTGCCCACTTGGTAGTCTTGGACCTTCTGCAGATACCCTATGAAAAGAGCGATGAAAAGATGAATGAAGTTATGAATCTAGCCCACACTTTTCTTCAGAATTTCTGCCGAGGAAATCCTCAGAATCAACTCCTCCATAAAAATCTCAATTTATTCCTAACTCCAGGGCTTCTGGAAGCTGAAACCATGATCTTCATGAATAATTACCTTCTTTGTAATGAAATTAGTGAGAGAGTGGTACAGCACTTTGTACACTGCATTGAGACCCATGGCCGCCACGTGGAATACCTGCGTTTCCTGCAGACCATTGTAAAAGCAGATGGCAAATATGTGAAAAAATGCCAGGACATGGTAATGACAGAGCTGATACTGATATTCTACAATGATAGAGCATCATTTCCAGTTCTACTCCAAATGATGTGTTCAGAGCGAGATGCAGATGAGAGTGGATTAGCATATCACATCACTCTAGTGGAATTGCTAGCAGCTTGTACGGAAGGATATACAGAGATCAAGTGCAATTCACTCCTGCCGGATGATATAGTGAGAGTGGTGACCCATGATGACTGCATACCTGAGGTGAAAATTGCCTATGTTAATTTTGTTAACCACTGTTACGTGGACACTGAGGTGGAAATGAAAGAAATCTATGCCAGTAACCACATTTGGAAGTTATTTGAGAACTTTCTTGTTGATATGGCAAGGGTTTGTAACACAACCACGGATCGTAAATCTCTGGAGAAATATGTCACTGAGCCTGTAATGAGCATTGTGAGTGGCTTCTTCAATTCTCCGTTTTCAGATAACAGCACCAGCCTCCAGACACATCAACCTGTTTTTATTCAGCTACTGCAGTCTGCTTTTAGAATTTACAACTGTACCTGGCCAAACCCAACTCAGAAAGCCTCAGTGGAGTCATGTATCAAAACTTTGGCTGAAGTGGCGAAGAACCGTGGGATTGCAATTCCGGTGGATTTGGACAGCCAGGTCAACACCTTGTTCATGAAGAGTCACAACATGGTGCAGAGGGCAGCCATGGGGTGGAGAATGTCAGCCCGCAGCGGACCACGTAAAGAAGCTCTTGGTGGGCCTGATTACAGGAACATAATAGAAAAACTGCAGGATGTAGTGTCCTCCTTGGAGCAGCAGTTCACTCCCATGATGCAGGCTGAATTCTCAGTGCTGGTTGATGTGCTGCACAGTCCAGAGCTTCTTTTTCCTGAAGGGAGCGATGCCATACGGTGTGGTGCTTTCATGTCCAAGTTGATAAATCACACAAAGAAGCTGATGGAGAAAAAGCTCTGCATTAAAATTCTTCAGACATTACGAGAAATGCTTGACAAGAAAACTAACTTTGCAGAAGGCAACACTTTAAGGAAACTGTACCGCTACTTTAAAGGAGAATATGGAAGTGGTAATAGCAAAACTGCACAAGTATCCATGTTTGATATTCAGTGCCTTCTGGATAAAGAAGGTGCATCAGAACTTGTCATAGTTATAGTCAGCACCAAAAATGACAGAATTTTCTCAGAAGGCATTTTGCTTGGTATTGCGTTGCTTGAAGGTGGAAATGCACAAACACAGTATTCAACTTACCAGCAACTGAAGGAGCAAAAAAAGTCAGAAAAATTCTTTAAAGTCCTGTATGACCGTATGATACGGTCAACAGTGACAGTGAACGATTTGGGGAGCAAAAAGAAAGATGATGATAGTGACCTAACCATATCTGTACCCAAAAGAGTGAAGGATTCACTGCACCTGAAAGAGGGTATGAAAGTTCAGTTAACAGAAGCATCTTCTGCAACATCCAAGGCTTACTCTGTATATAGAAGAGAAATGGACCCAGAAATAAACGCAGAGGAGTCCACAGAAGAAGCAGTAATGAGTCCTGCTATTGCAATCATGCAGCCAATACTGAGATTTCTCCAGCTGCTATGCGAGAACCACAACCGAGAGCTCCAGACCTGCATAGCTACCCATGAATCGAACGGGATTGATATTATAATTGCACTCATCTTGAATGACATAAACCCTCTTGGCAAATACTGCATGGACTTGGTGCTTCAGCTAAAGAACAATGCCTCCAAGCTTTTGCTGGCTATTATGGAAAGCAGGCAAGACAGTGAGAATGCGGAAAGAATCCTTTTCAACATGAGACCGAAGGAACTGGTGGATGTGATGAAGAATGCATATAACCAAGGCCTAGAATGTGACCATGAGGAGGAAAACGATGGCATCTCCCCAAAAGATGTTGGCCATAATATTTATATTTTGGCACATCAGTTGGCTCGTCACAATAAAACACTGCAGCAGATGCTGAAGCCAGGGTCAGATCCAGACGAAGGAGATGAAGCCTTGAGCCATTACGCCAATCATACAGCACAGATAGAGATTGTTCGTCATGACAGAACAATGGAACAGATTGTCTTCCCTGTCCCCAATATTTGTGAATTTCTCACTCGGGAATCCAAAAGTCGGGTATTCAATACAACAGAGAGAGATGAACAAGGGAGCAAAGTCAATGACTTCTTCCAACAGACAGAAGATCTGTACAATGAGATGAAATGGCAAAAGAAAATTAGGAATAATCCACTCCTATTTTGGTTCTCAAGACACATCTCTCTCTGGGGAAGTATTTCCTTCAACCTTGCTGTATTCATCAACTTAGCAGTTGCTCTATTCTATCCCTTT
a0006 CTCGTTGATGACAGATGTGTGCTTCAACCCGATGCTGGAGACCTCGCCAATCCACCCAAAAAGTTCAGAGATTGCCTCTTCAAGGTATGTCCTATGAACAGATACTCAGCCCAGAAACAATTCTGGAAAGCCAAACAAGGAAAACAAGGAAACAACACACAAGGAGACCTGTTTAAAAAGTTGCAGCATGCAGCAGAGCTGGAACAGAAGCAGAATGAGACTGAGAACAAGAAGGTCCTCGGAGACGTTGTCAAGTACAGTAATGTCATCCAGCTTCTTCACATAAAAAGTAACAAGTACTTGACTGTGAACAAGCGTCTCCCTGCGTTGCTCGAGAAAAATGCCATGCGCGTCTCCTTGGACCCTGCTGGGAATGAAGGTTCCTGGTTCTACATCCAGCCCTTCTGGAAGCTGCGCAGTGAAGGAGACAATGTCGTGGTTGGAGACAAGGTGGTCTTGATGCCGGTGAATGCAGGACAGCCGCTCCACGCCAGCAACATCGAGCTCTTGGATAATCTTGGTTGCAAAGAGGTCAATGCTGTTAACTGCAACACCAGCTGGAAAGTGACTTTGTTCATGAAGTTCAGCGACTATAGGGAAGATGTTTTGAAGGGGGGAGACGTGGTGAGGCTGTTTCATGCTGAGCAGGAGAAGTTCCTGACCTGTGATGGGTATAAAAGACAGCAGCATGTTTTTCTCAGAACCACGCTGCGGCAATCGGCCACCTCGGCCACCAGCTCCAAGGCTTTGTGGGAAGTTGAGGTTGTGCATTATGACCCGTGCAGGGGAGGAGCCGGCCACTGGAACAGCCTTTTCCGATTCAAGCACCTGGCAACCGGGAATTACCTCGCAGCTGAGAATGAGGATGCAGTGTACTCCAAAAGGAAGCATCAGGCAGAGAGGATCGCCTACACCCTGGTTTCTCTTCCAGGAAGCGACATTGCTTCTCTGTTTGAGCTGGACCCCACCACTCTACAGCGGACCGATTGTCCTGTTCCCAGAAACTCCTATGTGAGACTTCGGCACCTGTGCACCAACACCTGGGTGACCAGCACCAACTTTCCCATTGATGCAGAGGAGGAGCGACCAGTTATGCTTAAGATTGGCACCTGTCGCTCAAAAGAGGACAAAGAAGCTTTTGCCATCGTGTCCGTTCCGCTATCCGAAGTCAGAGACCTGGACTTTGCTAATGATGCCAGCAAGGTCTTGGAAGCGACAGTGAAGAAAATCCAGAATGATAACCTTCCTCAGAATGAGAGGAGGTTTGTGACCAAGCTCCTGGAGGACCTGGTTTTCTTTGTGTGTGTGGTACCAAACAACGGACAGGATGTTTCTGTGGCCACCTCATCTCCCAACCGAGAGAGGCAGAAACTCATGAGGGAGCAAAACATCCTTGCCCAGATATTTGGCATCCTTGAGGCTCCGTTTATAGATAATGGAGAAGGCGCCATGCTGAAGCTGGAGCAGCTGGGAGATCAGAGATATGCTCACATCAAGTACATCCTGAAACTCTGCTACAGAGTTCTGCGACATTCTCAACAGGACTATCGGAAGAATCAAGAAGCCAAAAATTTTTCCATCATGCAGTCTCAGATTGGGTACGAGATTCTAGCTGAAGACACAATCACTGCACTGCTGCACAACAACCGCAAGCTGCTTGAGCAACACATCACTGCCAGGGAGATCGAGACCTTTGTTAACCAGCTCAGGCGCAACCGGGAACCCAGATACCTGGATTATTTGTCTGATCTCTGTGTGTCCAACAAGATGGCCATCCCCGTCACACAGGAGCTTATCTGTAAATTTATGCTCAACCCCAGCAACGCTGAAATCCTCTTCCAAACCAAGCTAATCTCTAACATGAACGTGGAGTCCTCAATGCAGGAGGACATAGAGGAGGAGGAGGTCTGGCTCTACTGGATCGACAGCAACATACGCCACCTTGCACAGGATGCTAAGTCCGATGTGGAAAACATTACTTATTACAGGTATCAGCTGAACCTTTTTGCTAAGATGTGTTTGGACCGCCAGTACCTCGCCATCAACCAGATCTCCAGTCAGTTACCTGTGGATCTGATCCTGCGCTGCATGTTTGACGACTGCCTGCCCTACGACCTCAGAGCGGCCTTCTGCCGCCTCATGCTGCATATGCACGTAGACCGCGACCCGCAGGAGTCTGTGGTTCCGGTGCGCTACGCCCGCCTCTGGACTGAGATCCCCTCCAAGATCACTATCGACGAGTATGAGGAGTCAACGGACAGCTCGAGAGAGGACATGAAGAGGAAATTTGCCTCCACCATGGAGTTTGTGGAAGAATATCTCAAAGACGTAGTCAACCAGTCTTTTCCGTTTGGAGATAAGGATAAGAATGAACTCACTCTGGAGGTGGTAAATCTGGCTCGAAAGCTGGTTGACTTTGGTTTTTACAGCTTCAGCGAGCTGCTGCGGCTCACGCGCACCCTGCTGGCCATCCTGGACATTTATCCAGTCAACCTCATCAGCAAGCTGAACAAAGGTCCAGACTCAGGAAACAACGTTCTGCGAACGATTCATGGCGTCGGAGAAATGATGACTCAGATGGTGATGAGCCGAGGTGTGCCCCAAAATCTGCCCGACAGCCCACCTTCTTTGCGATATGGGAAAATGCCCGACGATGAGGACGACATGGTGATGGACACAAAACTGAAGATCATTGAGATCCTCATCCTCAGTGTGAGGATCACAAGTTCCGAGCAAAGTGCAGTGGAGCTGGATGAACAGGCCTTCCAGCTCCTGGTGTCTGAGCAAGATGTAGACAACTACATCAAGGCAGATCTGGACCAGCTGCGTCTGAAGTCTGAGGTCAGGGTACAGGAGGAGGACAACAAACCTCAGATTGACTCTAACAAGGGGAACAACTATAACATAGTCAAAGAGATCCTGCAGCGGCTCACAAAGCTGTGCAATCAAAGTAAGAAGAGCCGGGTGCAGCGCCTGCTGAAAAACATGGGAGCCCATACTGTGGTGCTGGACCTGCTGCAGATCCAGTATGAGCAGAATGATGAGAAGATGCAGCAGATAATGACGCTAGCTCACACATTTCTGCAGAACTTCTGCAAAGGAAACCATCAGAACCAACTTCTGCACAAACATCTTAATCTCTTTCTCACACCTGGGCTGCTGGAAGCTGAGACGATGATCTTCATGAACAACTATCAGCTGTGTAATGAGATCAGCGACCGTGTCGTCCATCACTATGTCCACTGCATCGAAACACACGGAAGACACACCAAATACCTCAAGTTTTTGGAAACCATTGTGAAATCCGATGGGAAGTATGTGAAGAAATGTCAGGACAAAGTCATGACAGAGCTGGTGCTGGTGTTCTACAATGACCGCTCATCCTTTCAAGTGCTGAAAGATCTGATGCGCTCGGAGCGGGAGAGCGACGAGGATGGCCTGGCGTATCACAACACCCTGGTGGAGCTGCTGGCCGCCTGCACTGAAGGCTACACCGAGCTAAAGTGCAACTCTCTGTTGCCCGATGACATTGTGAAAGTGGTCACGGAAGAGAACTGTGTTCCAGAGGTGAAAACTGCATATGTAAACTTTGTAAATCACTGCTATGTGGACACAGAGGTAGAAATGAAGGAGATCTACACATCCTGCCATATTTGGAAGCTCTTCGATAACTTCTTAGTGGACATGGCCACAGTGTGCAACACTACCATTGACCGTAACCTCTTAGAGAAGTATGTGACCGACGCGGTGATGGGCATCGTCAAGGGTTTCTTCAGCTCACCTTTCTCTGTAAATCACTCCGTGCTGCAGTCAAATCAATCTACATTCATCAAGCTGCTCCAGTCAGCTTTCAGACTGACAAATTGTAACTGGACCACCTCGGCTCAGAAGGCCAATATTGAGAGTTGTATCAAAACCCTGGCAGATGTTGCAAAGGCCCGGGCAATTGCCATCCCGGTCGATCTGGACAGTCAGGTCAACCATCTGTCGCTCAAGATCCATAGCACGGTGCAGCGGGCAGCTAAAGATTGGAGAATATCTGCCCGCTCACGACCTCGTAAGGAGCCACTGGGAGGCCCTGATTACAAGAACATAATTGACAAACTGCAGGGGGTTGTGTCCCTTCTTGAAGAGCAGTTCAGTCCCCTGGTCCAGGCGGAGTTCTCTGTTCTGGTTGACGTTCTTTACAGCCCTGAGCTGCTGTTTCCAGAAAATGCACGATTATGCGAGAGTGGCATCTTCATGTCAAAACTAATCAAACACACCAAGAAGCTCATGGACAANNNNNNNNNNCATAACCTTTTTCAAACAATTTTGATGTTGGATTTCACATTACGATTCTTTCTTCCAGGAAATGAGTTGAGAAAGCTCAACAGATACTTTAGGTCAGAGCTTGTGAGTGGAAACGTCAAGCCATCTGGTAACACCATGGTGGACATCCAGTGTCTTCTAGACTGCGTGGGAGCGTCAGAGCTGGTCATCCTCATCATGAACACCAAAAATGACCTTGTGTTTGAGGAGAGCATCCTGCTGGGTGTTGCTCTTCTGCGAGGCGGGAACACACAGACGCAGAACTCCTTCTACAGCCAGCTGTCCAAGCAGAAGAAGTCCGAGAAGTTCTTTAAGGTTTTCTATGACCGCATGATCCGAGCCACTGTGTCCGTCAACGAGCTGGGCTCCAGAAAAAGGGATGAGGACAGTGATGTCAGTTCCAACAGGTTTAAGAAAGGCAAAGAGTCTCTTTATTTAAGGGAGGAAATGCGAGGCCAACTGAAGGAGGCTTCTTCTGTCACCTCCAAGGCCTTCTGTGCCTTCAGGAAGGAACTGGACTCTGACCTGGGGACAGAAGAAATTATAGAGGAAATTCAGATGAGCCCCGCCATCACCATCATGAAACCCATACTCCGTTACCTTCAGCTGCTCTGTGAGAACCACAACTCTGACCTTCAGAGCTGCATCGTTAAGCATGAGTCAAATGGCATCGACATTATTATAGCACTGATCATCAACTCTATTAACCCCCTGGAGAAGAACCGACTTGACCTGGTGATGGAGCTCAAGAACAACGCTTCCAAACTGCTGCTGGCTATAATGGAGAGCCGCCATGACAGTGAGAATGCAGAGAAAATTCTCTACAAGATGAGGCCGATGGAGTTGGTAAGAAGGTGTGCGGAAGTCTATGCCCAAGGTCTGGAGAGCGAAGAGGAGGACAATATTTCTCAGATCACCTCCAGAGACGTCGGACACAACATTTACATCCTGGCTCACCAGTTGGCAAGACACAACAAACTTTTGCAGCAGTGCCTCAGACCTTCACCAGGGAAGGAGGACAGGGAGGATGCCCTTCATTACTACGCCAAACACACAGCGCAGATAGAGATTGTGCGTCATGATCGTACCATGGAGCAGATCGTATTTCCAGTGCCGAACATCTGCGAGTACATCACTGAGGAGTCCAAGATGCGCGTCTTCACCACCACTGAGAGAGATGACCAAGGCAGCAAGGTCAACGACTTCTTCCAGCAGTTTGACAACCTCTACAACGAGATGAAGTGGCAGAAGAAGATTCGCAAAAACAGAGTTCTCTTTTGGTTCTCAAGCCACATCTCACTTTGGGGGAGCATCTCTTTCTACCTGGCTAATCTGCTGAATTTTGTCGTGGCAACATTCTATCCTTTT
a0012 TTGGTGGATGACCGTTGTGTGGTGCACCCAGAGGCGGGAGACCTTGCCAACCCACCCAAGAAGTTCAGAGACTGCCTGTTCAAGGTGTGCCCTATGAATCGATACTCTGCCCAGAAGCAATACTGGAAAGCCAAGCAGGCGAAACAGGGGAACCATACAGAGGCTGCCCTGCTGAAGAAGCTCCAGCATGCTGCAGAGCTGGAACAAAAACAGAATGAGTCGGAGAACAGGAAACTTTTGGGAGAAATCGTGAAATACAGCAACGTTATCCAACTGCTGCACATAAAAAGCAACAAGTACCTGACGGTGAACAAGAGGTTACCTGCCTTGCTGGAGAAGAATGCCATGCGAGTGTCACTGGATGCTGCAGGGAACGAAGGCTCCTGGTTCTACATCCATCCGTTCTGGAAGCTGAGAAGCGAGGGTGATAATATCGTCGTAGGAGATAAAGTCGTTCTGATGCCTGTAAATGCTGGGCAGCCCCTGCATGCCAGCAACGTGGAGCTCTTGGACAACCCAGGCTGCAAAGAGGTGAATGCTGTTAATTGTAACACTAGCTGGAAAATCACTTTATTCATGAAATTCAGTTCCTATCGAGAGGATGTATTAAAGGGGGGTGATGTTGTGAGACTCTTTCATGCGGAACAAGAGAAATTTCTGACCTGTGATGACTATGAGAAAAAACAGCACATTTTCCTTCGGACGACCTTGCGTCAATCAGCAACTTCGGCCACTAGTTCTAAAGCACTCTGGGAAATAGAGGTGGTTCACCACGATCCATGCCGCGGAGGTGCGGGACAGTGGAACAGCCTGTTCAGGTTTAAGCATCTTGCCACTGGGAACTACTTAGCTGCAGAGAAAGACGAGATTCCAACACCAAAGAAAAAACGCCAGGCAGAGAAGATCATGTACACCCTGGTTTCAGTCCCAGGAAATGACATCGCGTCCCTTTTTGAACTTGATGCCACAACTCTGCAGAGAGCCGACTGCCTGGTTCCGAGGAACTCCTACGTGCGGTTAAGGCACTTGTGCACCAACACCTGGGTAACAAGCACCACCATCCCCATAGACACAGAGGAAGAGAGGCCTGTCATGTTGAAAATTGGGACCTGCCAGACCAAGGAAGACAAAGAAGCCTTTGCCATTGTGTGCGTCCCGCTGTCTGAGGTCCGTGACTTGGACTTTGCCAACGATGCCAACAAAGTGCTGGCCACCACGGTGAAGAAGCTGGAGAATGGCAGCATCACACAGAACGAGAGGAGGTTTGTGACTAAGTTGTTGGAAGACCTCATTTTCTTTGTGGCTGATGTGACCAACAATGGGCAGGACGTTGATGTGGTCATCACCAAGCCAAACCGGGAACGGCAGAAACTAATGAGGGAACAGAATATACTGGCACAGGTGTTTGGGATCCTTAAAGCACCTTTCAAGGAGAAGGGAGAAGGTTCGATGCTGAGGCTGGAGGACCTGGGCGACCAGCGCTACGCCCCGTACAAGTATGTGCTGCGTCTCTGCTACCGTGTGCTGCGGCATTCGCAGCAGGACTACAGGAAGAACCAGGAGGCTAAGAACTTCTGCGTTATGCAGTCCCAGATCGGCTATGATATCTTGGCAGAAGATACGATTACAGCCTTGTTACACAACAACCGCAAACTACTGGAGAAACACATCACAGCCAAAGAAATTGAGACTTTCGTCAGCCTGCTCAGGAGGAACCGGGAGCCGAGGTTTCTGGACTATTTGTCTGACCTCTGTGTGTCCAATAGCACGGCCATCCCCGTCACTCAGGAACTCATCTGCAAATTCATGCTGAGCCCTGGCAATGCGGACATCCTCATTCAGACAAAGCTGGTGTCCCAAGTGCCCATGGAGAGCTCCCTTCCTGATGACATTGACGATGAGGAGGTCTGGCTTTACTGGATTGACAGCAACATCAGGCACCTTGCCCAGGAAGCCAGGGAAGACCTGGAAGTTCTGACCTATTACAGGTACCAGCTAAACCTCTTTGCAAGGATGTGCTTGGACCGCCAGTATCTGGCCATCAACCAGATTTCAACACAGTTGTCCGTAGACCTGATCCTGCGGTGTGTGTCTGACGAGAGTCTGCCCTTTGACCTCAGAGCATCTTTCTGCCGACTCATGCTCCACATGCACGTTGACCGCGACCCCCAGGAGTCTGTAGTGCCTGTTCGCTATGCCCGCCTCTGGACCGAAATCCCCACAAAGATCACGATTCATGAGTATGACTCCATTACAGACTCTTCCAGAAATGACATGAAGAGGAAGTTTGCCCTGACGATGGAATTTGTCGAAGAATATTTGAAAGAAGTTGTAAATCAACCATTTCCTTTTGGAGACAAAGAGAAAAATAAACTGACATTTGAGGTGGTTCACCTAGCCCGGAACCTCATCTATTTCGGATTCTACAGCTTCAGCGAGTTACTGCGGCTGACGAGAACTCTGCTGGCGATCCTAGACATCGCCCCCATGTCATATTTCGAAAGATTAAGCAAGTTCCAAGATGGAAGCAACAATGTCATGAGGACCATCCACGGAGTGGGAGAGATGATGACACAGATGGTGCTCAGCAGAGGCTTCCCAGTGAGTGTGCCCGACGCACAGCCCATCGTCCACCCCAGCAAGCCCGGCGAGCAGGAGGATGTGACAGTGATGGACACCAAGCTGAAGGTTATCGAGATTTTAATCCTGAGCGTCCGGATCTCTAGAAAAGAAAAAACTCCAGTTCAGCTTGATGATCAGGCCTTTCAGTTACTAGTGTCGAACCAAGATGTTGATAACTACATCAAGGCAGACCTCGACCAACTTCGGCTGAAATCTGAGGCCAAAGTGCAGGATGGCGCGAAGACACCTCAGATCGACAGCAACAAGGGCAACAACTACCGGATCGTCAAGGAGATCTTGATTAGGCTGAGTAAGCTCTGTGTGCAGAACAAGAAATGCCGTAATCAGCGGCTGCTGAAAAACATGGGGGCTCACTCCGTGGTGCTGGACCTTCTGCAGATCCCCTATGAGAAGACCGACGAGAAGATGAACGAGGTGATGGACTTAGCCCACACCTTCCTGCAGAACTTCTGCCGTGGGAATCCGCAGAACCAACTCCTTCACAAGCATCTCAATCTGTTCCTAACTCCTGGCCTCCTGGAGGCAGAAACCATGATCTTCATGAACAATTATCACCTGTGCAACGAGATCAGCGAGAGGGTGGTCCAGCACTTCGTGCACTGCATTGAGACACATGGCCGCCATGTGGAGTACCTGAGGTTCCTGCAGACGATCGTGAAAGCAGATGGCAAATACGTGAAGAAATGCCAGGACATGGTGATGACGGAGTTGATCTTGATATTCTACAATGACAGAGCTTCATTTCCCATCCTCCTCAACATGATGTGCTCTGAGAGAGCCGGGGACGAGAGCGGCCTCGCCTACCACATCACCCTTGTGGAGTTGCTGGCAGCGTGCACCGAAGGCTACACAGAAATCAAGTGCAATTCTCTCTTGCCTGACGACATAGTGAGAGTGGTGACCCACGATGACTGCATTCCTGAGGTCAAAATCGCGTACGTGAACTTTGTCAACCATTGCTACGTTGACACTGAAGTGGAGATGAAGGAGATCTACACAAGTAACCACATTTGGAAGTTATTTGAGAATTTCTTGGTGGATATGGCGAGGGTCTGTAACACCACCACAGACAGGAAATTTCTGGAGAGGTGTGTGACAGAGTCAGTCATGAACATTGTGAGCGGCTTCTTCAACTCGCCATTTTCCGACAACAGTACCAGCCTCCAGACCCACCAGCCAGTCTTTATCCAGCTGCTGCAGTCTGCCTTCAGAATTTACAACTGTACCTGGCCCAACCCAGCCCAGAAAGCCTCCGTAGAATCCTGTATCAGAGCCCTGGCTGAAGTGGCCAAAAACCGTGGGATTGCGATCCCAGTCGATTTGGACAGCCAGGTCAACACGCTCTTCATGAAGAACCACAGTACGGTGCAGAGGGCAGCCATGGGCTGGAGACTCTCAGCTCGCTCTGGACCTCGCAAGGAAGCTCTTGGAGGACCAGATTACAGAAATATTATTGAAAAGTTACAGGATGTCGTGGCCTCCCTGGAACAGCAGTTCAGCCCCATGATGCAGGCCGAGTTCTCTGTGCTTGTGGATGTGCTGTACAGCCCGGAGCTACTGTTCCCAGAGGGAAGCGACGCCATCCGATGTGGTGCCTTCATGTCCAAGCTGATTAATCACACAAAGAAACTGATGGAGAAAAAGCTGTGCATTAAAATCCTCCAGACTTTACGGGAGATGCTGGAGAAGAAAGACAGCTTCATGGAAGGTAGCACATTACGGCGACTGAATCGGTACTTCAAGGGTGATCATAGCATTAGTAACGCCAAGACAGCACAAATTTCAATGTCCGATATCCAGTGTTTGCTGGACAAAGAAGGAGCATCCGAACTTGTCATCGTCATTGTGAACACCAAAAACGACAGGATCTTTTCCGAAGGAATTTTGCTTGGCATTGCCTTGCTGGAAGGAGGAAACACACAGACCCAGTATTCTTTCTACCAGCAGTTGCATGAACAAAAAAAGTCAGAGAAATTTTTCAAAGTCCTTTATGATCGGATGATCAGATCCACGGTGACCGTCAACGACTTAGGGAGCAAGAAGAGAGAAGAGGACAGTGACGTCATGGCCCTGGGCCCTCGGAGAGTGAGAGACTCACTACATTTGAGAGAAGGAATGAAAGGGCAGTTAACAGAAGCGTCTTCAGCCACATCCAAAGCATACTGTGTGTACAGAAGAGAGATGGACCCGGAAATAAGTGCGGAGGAATCTGCGGAGGAAGTTACCATGAGCCCGGCCATCACCATCATGCGTCCCATCCTCAGGTTCCTGCAGTTACTGTGTGAGAATCATAACCGGGAGCTTCAGACCTGTATCGCCACTCACGAATCCAATGGGATTGATATCATCATCGCCTTGATTCTGAATGACATCAACCCCCTGGGCAAGTACAGAATGGACTTGGTGTTGCAGCTGAAGAACAACGCCTCCAAGCTTCTGCTGGCCATTATGGAGAGCAGACATGACAGTGAGAATGCAGAGAGAATTCTTTTCAACATGAGACCCAGGGAACTGGTGGATGTCATGAAGAATGCCTATAACCAAGGCCTGGAATGTGACCATGACGAGGAGGGAGATGGTGTTTCTCCAAAAGACGTTGGACACAACATCTACATTCTGGCCCATCAGTTGGCCCGCCACAACAAACTGCTGCAGCAGATGCTCAAGCCGGGATCTGACCCAGAGGAAGGGGATGAAGCTTTGAAGTATTACGCCAACCACACCGCGCAGATCGAGATTGTGCGGCATGACCGGACTATGGAGCAGATTGTTTTCCCGGTCCCCAACATCTGTGAATTCCTCACTCGGGAATCCAAGTACCGAGTGTTCAACACAACGGAGAGGGATGAGCAAGGAAGCAAGGTGAACGACTTCTTCCAGCAAACGGAAGATCTCTACAACGAGATGAAATGGCAAAAGAAGATCAGAAACAACCCCGCCCTGTTCTGGTTCTCCAGGCACATCTCACTCTGGGGGAGCATCTCCTTCAACCTGGCTGTGTTCATCAACCTGGCTGTGGCTCTCTTCTACCCATTC
a0005 TTAGTGGATGACAGATGTGTGGTGCACCCAGAGGCTGGGGACCTTGCCAACCCTCCCAAGAAGTTCAGAGACTGCCTTTTCAAGGTGTGCCCTATGAACCGATATTCTGCCCAGAAGCAATATTGGAAAGCCAAGCAAGCCAAACAAGGGAACCACACCGAGGCAGCCTTGCTGAAGAAACTACAGCACGCTGCAGAACTGGAACAAAAACAAAATGAATCAGAGAATAAGAAGCTGTTGGGAGAAATTGTGAAATACAGTAATGTTATACAACTACTGCATATAAAAAGCAACAAATATCTTACTGTCAACAAGAGATTGCCTGCTTTACTGGAGAAGAATGCCATGCGTGTGTCCTTGGATGCTGCGGGAAACGAAGGGTCTTGGTTTTATATTCATCCCTTCTGGAAGCTGAGAAGCGAGGGTGACAATATTGTTGTAGGAGATAAAGTTGTTTTGATGCCTGTGAATGCAGGACAGCCACTACATGCCAGCAACATAGAGCTTCTTGATAACCCAGGGTGTAAAGAGGTGAATGCTGTTAATTGCAACACCAGCTGGAAAATCACTTTATTCATGAAATATAGTTCCTATCGAGAGGATGTATTAAAAGGAGGGGACGTTGTTAGATTGTTTCATGCGGAACAAGAGAAGTTTTTGACTTGTGATGAATACGAGAAAAAACAGCACATTTTCCTTCGTACAACCTTGCGCCAATCAGCTACTTCTGCTACTAGTTCTAAAGCGCTGTGGGAAATAGAGGTGGTTCATCATGACCCATGCCGTGGGGGTGCAGGACAGTGGAACAGCTTGTTCAGATTTAAACATCTTGCAACTGGAAACTATTTAGCTGCAGAGAGAGATGACCATCCAACTTCAAAGAAAAAACGCCAGGCAGAGAAGATCATGTATACTTTGGTTTCAGTCCCAGGCAATGACATTGCATCCCTTTTTGAACTCGATGCCACAACTCTTCAGAGAGCTGACTGCCTGGTTCCAAGGAACTCATATGTTCGGTTAAGGCATTTATGCACCAACACATGGGTAACCAGTACTAGTATCCCCATAGACACAGATGAAGAGAGGCCTGTTATGTTAAAGATTGGAACCTGCCAAACCAAAGAAGATAAAGAAGCGTTCGCCATCGTGTCTGTCCCACTGTCTGAAGTTCGAGACTTAGACTTTGCCAATGATGCCAATAAAGTACTAGCGACCACAGTTAAAAAGCTAGAAAATGGCACAATAACTCAGAATGAAAGGAGGTTTGTAACCAAATTATTGGAAGACCTCATCTTCTTTGTTGCTGATGTGCCTAATAATGGACAAGAAGTTGATGTGGTTATCACTAAGCCAAACCGAGAGCGTCAAAAATTGATGAGGGAACAAAACATACTGGCGCAGGTATTTGGAATTCTTAAAGCACCCTTTAAAGAGAAAGGAGAAGGCTCAATGCTGCGACTTGAAGATCTTGGGGATCAAAGATATGCACCCTACAAGTACATGCTGCGGCTCTGTTACCGTGTCCTGAGACACTCTCAGCAGGATTACCGGAAAAATCAGGAAGCTAAGAATTTCTGTGTCATGCAGTCCCAGATTGGCTATGATATTTTGGCAGAAGATACTATCACAGCTTTGTTGCACAACAACAGAAAACTACTAGAGAAACATATCACAGCAAAAGAAATAGAAACATTTGTCAGTTTACTCAGGAGAAATCGGGAGCCAAGGTTTTTGGATTATTTGTCAGATCTGTGTGTGTCTAATACCACTGCTATTCCTGTAACTCAAGAACTCATCTGTAAATTTATGTTGAGTCCAGGCAATGCAGACATTCTCATTCAAACTAAGGTGGTCTCACAAGCACCCATGGAGAGCTCCCTTTCCGATGACATTGACGATGAAGAAGTTTGGCTCTATTGGATTGACAGCAACATCAGGCACCTTGCTCAAGAGGCAAAAGAAGACTTAGAAGTTCTTACCTATTACAGGTACCAGCTAAACCTCTTTGCAAGGATGTGCTTGGATCGCCAGTATCTGGCCATAAACCAGATTTCTACACAGCTCTCTGTAGACCTGATCCTGCGGTGTGTGTCGGATGAGAGCCTGCCGTTCGACCTCCGAGCGTCCTTCTGTCGCCTCATGCTCCACATGCACGTTGACCGGGATCCCCAGGAGTCTGTGGTGCCTGTTCGCTATGCCAGGCTCTGGACAGAAATCCCCACAAAGATCACAATTCATGAATATGATTCTATAACAGACTCTTCCCGAAATGATATGAAGAGGAAATTTGCCCTGACAATGGAATTTGTTGAAGAATATTTGAAAGAAGTCGTAAACCAGCCCTTTCCTTTTGGGGATAAAGAAAAAAATAAACTGACATTTGAGGTGGTCCACTTGGCTCGGAATCTTATATACTTTGGATTTTATAGTTTCAGTGAGTTATTAAGGCTAACAAGAACACTTCTGGCTATTTTAGACATTGCCCCCATGTCATACTTTGAAAGATTAAGCAAATTTCAAGATGGAGGAAACAATGTGATGAGAACCATTCATGGGGTGGGAGAGATGATGACCCAGATGGTACTCAGTAGAGGCTTCCCCATGAGCGTGCCAGATGTGCCACCCAGCATCCACCCGAGCAAGCCCGCCGAGCATGAGGATGTGACTGTGATGGACACCAAGCTGAAGATCATTGAGATTTTGATCCTGAGTGTCAGGATCTCAAGAAAGGAAAAAAACCCAGTTCAACTTGATGATCAGGCATTTCAATTACTGGTGTCTAATCAAGATGTAGATAACTACATCAAGGCAGATCTAGACCAGCTTCGACTGAAGTCTGAGGTGAAAGTGCAGGATGGAACAAAGAAACCTCAGATTGACAGCAACAAGAGCAATAACTACCGGATTGTAAAGGAGATTTTGATTAGGCTAAGTAAACTCTGTGTACAGAATAAAAAGTGTCGGATTCAACGATTACTGAAAAATATGGGGGCACATTCAGTGGTGCTAGATCTTCTCCAGATACCCTACGAAAAGAATGATGAAAAAATGAACGAAGTAATGAATCTAGCCCATACGTTTCTGCAGAATTTCTGTCGAGGAAATCCACAGAATCAACTTCTTCATAAACATCTGAATTTGTTTTTAACTCCAGGTCTCCTTGAAGCAGAAACCATGATCTTCATGAACAATTACCATCTGTGCAACGAAATTAGCGAGAGAGTTGTACAGCACTTTGTGCACTGCATTGAGACACATGGCCGCCACGTGGAGTACCTGAGGTTTTTGCAAACAATTGTGAAAGCAGATGGTAAATATGTGAAGAAATGCCAGGATATGGTAATGACAGAGTTGATACTGATATTTTACAATGATAGAGCGTCATTTCCCATCCTTCTCCATATGATGTGTTCAGAGAGAGACGGGGATGAGAGTGGCTTAGCCTACCACATCACCCTGGTGGAGCTGCTGGCAGCATGCACAGAGGGGTACACTGAAATCAAGTGTAATTCCCTTCTCCCGGACGACATAGTGAGGGTGGTGACCCATGACGACTGCATCCCTGAGGTTAAAATTGCTTATGTGAACTTTGTTAATCACTGTTATGTTGACACTGAAGTGGAAATGAAAGAAATCTATACAAGTAACCACATTTGGAAATTATTTGAGAACTTCTTGGTGGATATGGCAAGGGTTTGCAACACAACTACAGACAGGAAATTTTTGGAAAAGTGTGTTACTGAGTCAATAATGAATATTGTGAGCGGCTTCTTTAATTCCCCCTTTTCAGACAATAGTACCAGCCTCCAGACACATCAGCCAGTTTTTATTCAGCTACTGCAATCTGCCTTCAGAATTTACAATTGCACCTGGCCAAACCCGTCACAGAAAGCCTCGGTGGAATCCTGTATCAGAACTTTGGCTGAAGTGGCAAAAAATCGTGGAATTGCCATTCCAGTGGATTTGGACGGCCAAGTTAATACTCTTTTCATGAAGAGCCATAATATGGTGCAGAGAGCAGCAATGGGTTGGAGACTATCAGCTCGCTCTGGGCCACGCAAGGAAGCTCTTGGAGGGCCTGATTACAGAAATATTATTGAAAAGTTACAGGATGTAGTGGCCTCCTTGGAGCACCAGTTCAGCCCAATGATGCAGGCTGAATTCTCAGTGTTGGTTGATGTATTGTACAGTCCAGAGCTGCTGTTCCCTGAGGGAAGCGATGCAATAAGATGTGGCGCTTTCATGTCAAAGTTGATTAATCATACAAAGAAACTAATGGAGAAAAAACTGTGCATTAAAATTCTTCAGACATTACGAGAAATGTTAGAGAAGAAAGACAGCTTTGTGGAAGGTAACACATTAAGAAAGCTGAATCGATACTTTAAAGGTGATTATAGTATTGGCAATTCCAAAACTGCACAGATATCAATGTCAGATATTCAGTGTCTGCTGGATAAAGAAGGTGCCTCAGAACTTGTCATCGTTATAGTGAACACCAAAAATGACAGAATTTTTTCAGAAGGCATTTTCCTCGGCATTGCCTTGCTCGAAGGAGGAAATACACAAACACAGTATTCTTTCTACCAGCAGTTGCATGAACAAAAAAAGTCAGAAAAATTCTTTAAAGTTCTCTATGATCGAATGATAAGATCAACAGTGACAGTTAATGATTTAGGTAGCAAAAAAAGGGATGATGACAATGAATTGATGACATCTGGTCCACGAAGAGTAAGAGATTCACTACATTTAAAAGAGGGAATGAAAGGGCAATTAACAGAAGCTTCTTCAGCAACATCCAAAGCATATTGTGTATACAGAAGAGAAATGGATCCAGAAATAAACACTGAGGAATCTGCAGAGGAAGTAACAATGAGTCCTGCAATTGCCATCATGCAGCCAATACTGAGATTTCTTCAGTTACTGTGTGAGAATCACAACCGGGAATTACAGACCTGTATCGCTACACATGAGTCTAATGGGATTGATATCATCATTGCTTTGATTCTGAATGACATAAACCCTCTTGGTAAATACCGAATGGATCTGGTGCTCCAGCTAAAGAACAATGCATCTAAACTTTTGCTGGCCATTATGGAAAGCAGACATGACAGCGAGAACGCAGAAAGAATTCTTTTTAACATGAGACCCAGAGAACTGGTGGATGTGATGAAGAATGCCTACAACCAAGGATTGGAATGTGACCATGATGACGAGGGTGATGGTGTTTCTCCAAAAGATGTTGGACACAATATCTATATTCTGGCCCATCAGTTGGCCCGCCACAATAAACTGTTGCAGCAGATGCTCAAACCAGGATCGGATCCAGATGAAGGAGATGAAGCCTTAAAGTATTATGCCAACCACACTGCACAGATTGAGATTGTCCGGCATGATAGGACCATGGAACAAATAGTTTTTCCTGTCCCCAATATATGTGAATACCTCACTCGAGAATCCAAGTGCCGTGTGTTCAATACAACTGAAAGGGATGAACAAGGAAGTAAAGTGAATGACTTTTTCCAGCAAACAGAAGATCTCTACAATGAAATGAAGTGGCAAAAGAAAATCAGGAATAACCCTGCACTGTTCTGGTTCTCGAGGCACATCTCTCTCTGGGGGAGCATTTCCTTCAACCTGGCTGTGTTCATCAATTTAGCTGTTGCTCTCTTCTACCCATTC
a0008 TTGGTGGATGACCGTTGTGTGGTGCATCCGGAGGCGGGGGATCTTACCAACCCACCCAAGAAGTTCAGAGACTGCCTCTTCAAGGTGTGCCCCATGAATCGATACTCTGCCCAGAAGCAGTACTGGAAAGCCAAGCAGGCGAAGCAGGGAAACCACACGGAGGCTGCCCTGCTGAAGAAGCTCCAGCACGCCGCAGAGCTGGAACAAAAACAGAATGAGTCAGAGAACAGGAAACTTTTGGGAGAAATTGTGAAATACAGCAACGTTATACAACTACTGCACATAAAAAGCAACAAGTACCTCACCGTGAACAAGAGGTTACCTGCCTTACTGGAGAAGAATGCCATGCGTGTGTCCCTGGATGCTGCAGGGAACGAAGGGTCCTGGTTCTACATCCATCCCTTCTGGAAGCTGAGAAGCGAGGGTGATAATATCGTCGTGGGAGATAAAGTCGTTCTGATGCCTGTAAATGCTGGGCAGCCCCTGCATGCCAGCAACGTGGAGCTCCTGGACAACCCCGGCTGCAAAGAGGTGAATGCTGTTAATTGCAACACTAGCTGGAAAATCACTTTATTCATGAAGTTCAGCTCCTACCGAGAGGATGTATTAAAAGGGGGTGACGTTGTGAGACTGTTTCATGCGGAACAAGAGAAGTTTCTGACCTGTGATGACTATGAGAAAAAACAGCACATTTTCCTGCGGACGACCTTGCGTCAATCAGCAACGTCGGCCACTAGCTCTAAAGCACTCTGGGAGATAGAGGTGGTTCACCATGATCCATGCCGCGGAGGTGCAGGACAGTGGAACAGCCTGTTCAGGTTTAAGCATCTTGCAACTGGGAACTACTTAGCTGCAGAGAGAGACGAGCTTCCAACCTCAAAGAAAAAACGCCAGGCAGAGAAGATCATGTACACGCTGGTCTCGGTCCCGGGAAATGACATCGCGTCCCTTTTTGAACTTGACGCCACAACTCTGCAGAGAGCTGACTGCCTGGTTCCGAGGAACTCCTACGTGCGGTTGAGGCACCTGTGTACCAACACGTGGGTAACAAGCACCAGCATCCCCATAGACACAGAGGAAGAGAGGCCTGTCATGCTGAAAATTGGGACCTGCCAGACCAAGGAAGACAAAGAAGCCTTTGCCATCGTGTGCGTCCCGCTGTCTGAGGTCCGAGACCTGGACTTTGCCAACGATGCCAACAAAGTATTGGCCACCACGGTGAAGAAGCTGGAGAATGGCAGCATCACCCAGAATGAGAGGAGGTTTGTGACTAAGTTGTTGGAAGACCTCATTTTCTTTGTGGCTGATGTGACCAACAACGGACAGGATGTTGATGTGGTCATCACCAAGCCCAACCGGGAACGGCAAAAACTAATGAGGGAACAGAATATTCTGGCACAGGTGTTTGGGATCCTTAAAGCCCCTTTCAAGGAGAAGGGGGAAGGCTCGATGCTGAGGCTGGAGGACCTGGGCGACCAGCGCTATGCCCCGTACAAGTACGTGCTGCGTCTCTGCTACCGCGTGCTGCGGCATTCGCAGCAGGACTACAGGAAGAACCAGGAGGCTAAGAACTTCTGCGTCATGCAGTCTCAGATCGGCTATGATATTTTGGCAGAAGATACGATCACAGCCTTGCTACACAACAACCGCAAACTCCTGGAGAAACACATCACGGCCAAAGAAATCGAGACCTTCGTCAGCCTGCTCAGGAGGAACCGGGAGCCGAGGTTTCTGGACTATCTGTCTGACCTCTGCGTGTCCAATAGCACCGCCATCCCTGTGACTCAGGAGCTCATCTGCAAATTCATGCTGAGCCCCGGCAATGCGGACATCCTCATTCAGACGAAGCTGGTGTCCCAAGTGCCCATGGAGAGTTCCCTTCCCGATGACATCGACGACGAGGAGGTTTGGCTTTACTGGATTGACAGCAACATCAGGCACCTGGCCCAGGAGGCCAGGGAAGACCTAGAAGTCCTGACCTATTACAGGTACCAGCTAAACCTCTTTGCAAGGATGTGCTTGGACCGCCAGTACCTGGCCATCAACCAGATTTCAACACAGCTGTCTGTAGACCTGATCCTGCGGTGCGTGTCTGACGAGAGCCTGCCCTTTGACCTCCGAGCCTCTTTCTGCCGACTCATGCTCCACATGCACGTGGACCGGGACCCCCAGGAGTCTGTGGTGCCTGTCCGCTACGCCCGGCTCTGGACTGAGATCCCCACCAAGATCACGATCCATGAGTATGACTCCATCACAGACTCTTCCAGAAATGACATGAAGAGGAAGTTTGCCCTGACAATGGAATTTGTCGAAGAATATTTGAAAGAAGTTGTGAATCAACCGTTTCCTTTTGGAGACAAAGAGAAAAATAAACTGACATTTGAGGTGGTCCACCTGGCCCGGAACCTCATCTACTTCGGATTCTACAGCTTCAGCGAGTTGCTGCGGCTGACGAGAACTCTGCTGGCGATCCTGGACATCGCCCCCATGTCGTATTTTGAAAGATTAAGCAAGTTTCAAGATGGAAGTAAGAACTCTGAGGAATCCCTTGTCTCTGCTTCTGGAATGCTGGGGAGGCTTAGTCAGTCGAGAGGAGTACAGTTAGACCAGACCTCAGCTCAACACATGGAGGGTTGGAGCTGGTCTGCCCAGGAGTGTGACATGCGTGTTAATAGAACTAAGCTTGCCATGTTGCTTCTTCTAATCCTGAGTGTCCGTATCTCTAGAAAAGAAAAAACTCCAGTTCAGCTTGATGATCAGGCCTTCCAGTTACTAGTGTCGAACCAAGATGTCGATAACTACATCAAGGCAGACCTGGACCAACTTCGGCTGAAGTCCGAGGCCAAAGTGCAGGACGGCGCGAAGACACCTCAGATCGACAGCAACAAGGGCAACAACTACCGGATCGTCAAGGAGATCTTGATTAGGCTGAGTAAGCTCTGTGTGCAGAACAAGAAATGTCGTAATCAACGGTTGCTGAAAAATATGGGGGCTCACTCCGTGGTACTGGACCTTCTGCAGATCCCCTATGAGAAGACCGACGAGAAGATGAACGAGGTGATGGACTTAGCCCACACCTTCCTGCAGAACTTCTGCCGCGGGAATCCACAGAACCAACTCCTTCACAAGCATCTCAACCTGTTCCTAACCCCTGGACTCCTGGAGGCGGAAACCATGATCTTCATGAACAATTACCATCTGTGCAATGAGATCAGCGAGAGGGTGGTCCAGCACTTTGTGCACTGCATTGAGACACACGGCCGCCACGTGGAGTACCTGAGGTTCCTGCAGACCATCGTGAAAGCAGACGGCAAATACGTGAAGAAATGCCAGGACATGGTGATGACCGAGCTGATCCTGATATTCTACAACGACCGAGCCTCATTTCCCATCCTTCTCAACATGATGTGCTCCGAGAGAGCCGGGGATGAGAGCGGCCTGGCCTACCATATCACCCTTGTGGAGTTGCTGGCAGCGTGCACTGAGGGGTACACGGAGATCAAGTGCAATTCTCTCTTGCCTGACGACATAGTGAGGGTGGTGACCCACGACGACTGCATTCCTGAGGTAAAAATTGCATACGTGAACTTTGTCAACCATTGTTACGTTGACACAGAAGTGGAGATGAAGGAAATCTATACAAGTAACCACATTTGGAAGTTATTTGAGAACTTCTTGGTGGATATGGCAAGGGTCTGCAACACCACCACGGACCGGAAATTTCTGGAGAGGTGTGTGACAGAGTCAGTCATGAACATCGTGAGCGGCTTCTTCAACTCGCCGTTTTCGGATAACAGTACCAGCCTCCAGACCCATCAGCCGGTCTTTATCCAGCTGCTGCAGTCCGCCTTCAGAATTTACAACTGCACCTGGCCCAACCCAGCCCAGAAAGCCTCCGTGGAATCCTGCATCAGAGCCCTGGCTGAAGTGGCCAAAAACCGTGGGATTGCGATTCCGGTGGATTTGGACAGCCAGGTCAACACACTCTTCATGAAGAATCACAGTACAGTGCAGAGGGCGGCCATGGGCTGGAGGCTCTCTGCTCGCTCCGGACCTCGCAAGGAAGCTCTTGGAGGGCCAGACTACAGGAATATTATTGAAAAGTTACAGGATGTCGTGGCCTCTCTGGAACAGCAGTTCAGCCCCATGATGCAGGCTGAGTTCTCTGTGCTTGTGGATGTGCTGTACAGCCCGGAGCTACTGTTCCCAGAAGGAAGCGATGCCATACGATGTGGTGCCTTCATGTCCAATATGATTAATCACACAAAGAAACTGATGAAAAAAAAACTGTGCATTAAAATCCTCCAGACGTTACGGGAGATGCTGGAGAAGAAAGACAGCTTCATGGAAGGTAGCACATTACGGAAACTGAATCGGTACTTCAAGGGTGACCACAGCGTTGGTAACGCCAAGACAGCACAAATTTCCATGTCCGATATCCAGTGTTTGCTGGACAAGGAAGGGGCCTCCGAACTTGTCATCGTCATTGTGAACACCAAAAACGACAGGATCTTTTCCGAGGGCATCTTGCTTGGCATTGCCCTGCTGGAAGGAGGAAACACACAAACCCAGAATTCTTTCTACCAGCAGTTGCATGAACAAAAAAAGTCAGAGAAATTCTTCAAAGTCCTTTACGATCGGATGATCAGATCCACGGTGACTGTCAACGACTTAGGGAGCAAGAAGAGAGAGGAGGACAGTGACCTCATGGCCTTGGGCCCTCGGAGAGTGAGAGACTCACTGCATTTGAAAGAGGGAATGAAAGGGCAGTTGACTGAGGCGTCTTCAGCCACGTCCAAAGCATACTGTGTGTACAGAAGGGAAATGGACCCAGACATTAGTGCGGAGGAATCTGCAGAGGAAGTTACCATGAGCCCAGCCATCACTATCATGCGGCCCATCCTCAGGTTCCTGCAGTTACTGTGTGAGAATCACAACCGGGAGCTTCAGACCTGTATCGCCACTCACGAATCCAATGGGATTGACATCATCATCGCCTTGATTCTGAGTGACATCAACCCTCTGGGCAAGTACAGAATGGACCTGGTGCTACAGCTGAAGAACAACGCCTCCAAGCTTCTGCTGGCCATTATGGAGAGCAGACACGACAGTGAGAATGCAGAGAGAATTCTCTTCAACATGAGACCCAAGGAACTGGTGGATGTCATGAAGAATGCCTATAACCAAGGCCTGGAATGTAACCATGACGAGGAGGGAGATGGTGTTTCTCCAAAAGACGTTGGACACAACATCTACATCCTGGCCCATCAGTTGGCCCGCCACAATAAACTCCTACAGCAGATGCTCAAGCCTGGATCCGATCCAGAGGAAGGGGATGAAGCCTTGAAGTACTATGCCAACCACACCGCACAGATCGAGATTGTGCGGCACGACCGGACTATGGAGCAGATTGTTTTCCCCGTCCCCAATATCTGCGAATTCCTCACTCGGGAATCCAAATACCGGGTGTTCAACACAACGGAGAGGGATGAGCAAGGAAGCAAGGTGAACGACTTCTTCCAGCAAACGGAAGATCTCTACAACGAGATGAAATGGCAAAAGAAGATCAGGAACAACCCCGCCCTGTTCTGGTTCTCCAGGCACATCTCCCTGTGGGGGAGCATCTCCTTCAACCTGGCTGTGTTCATCAACCTGGCCGTGGCTCTCTTCTACCCATTC
a0001 CTTGTCGATGACAGGTGTGTGGTCCAGCCTGAAGCTGGAAACCTGGCCAACCCACCCAAAAAGTTCAGAGACTGCCTCTTCAAGGTGTGTCCCATGAACAGGTACTCGGCCCAGAAGCAATTCTGGAAGGCCAAACAGGGAAAACAAGGGCACAACACGCAGGGAGACCTTTTCAAGAAGTTACAGGATGCAGCAGAACTGGAGATGAAGCAGAACGAGTCGGAGAACAAGAAGCTCCTCGGGGAAGTTGTGAAATACAGTAACGTCATCCAGCTCCTGCACATTAAGAGCAACAAATACCTGACGGTGAACAAGCGTCTCCCTGCTCTGCTCGAGAAGAACGCCATGCGGGTTTCTTTGGACTCGGCGGGGAACGAGGGCTCCTGGTTCTACATTCAGCCTTTCTGGAAGCTCCGCAGCGAAGGAGATAACGTGGTGGTTGGCGACAAGGTTGTGCTGATGCCGGTGAACGCAGGGCAGCCTCTTCACGCCAGTAACATCGAGCTGCTGGACAACCTCGGCTGCAAAGAGGTTAATGCTGTTAACTGCAACACCAGCTTTAAGATCACCTTGTTCATGAAGTTCAGCGACTACAGGGAAGATGTGCTGAAGGGGGGGGACGTGGTGAGGCTGTTTCACGCCGAGCAGGAGAAGTTCCTGACCTGTGACGAGTACAAGAAGCAGCAGCACGTCTTCCTCCGGACCACGCTGCGGCAGTCCGCCACCTCCGCCACCAGCTCCAAGGCCCTCTGGGAGATCGAGGTCGTGCACCATGACCCCTGTAGAGGTGGAGCCGGACAGTGGAACAGTCTCTTCCGCTTCAAACACCTGGCGACTGGGAATTACCTCGCAGCAGAGAACGAGGAGACTTTGTTCTCCAAGAGGAAGCATCAAGCAGAGAAGATTGCTTACACCCTGGTTTCTGTTCCTGGCAATGACATCTCCTCTCTGTTTGAGCTGGATGCCACCACTCTGCAGCGTGCCGACTGTCTCGTGCCCAGAAACTCCTATGTGAGACTGCGGCACCTGTGCACCAACACGTGGGTGACAAGTACCAACGTCCCCATCGATGTGGAGGAGGAGCGTCCAGTCATGCTCAAGATTGGAACCTGTTGCACTAAAGAGGACAAAGAAGCTTTCGCCATCGTATCTGTTCCCCTGTCGGAGGTCAGAGACTTGGACTTTGCCAATGACGCTAGCAAGGTCCTGGAGTCCACCGTGAGGAAGCTTCAGTTCGGCAACATTGCTCAGAATGAGAGGAGGTTTGTGACTAAGCTGCTGGAGGACCTCGTTTTCTTTGTATGTATGGTACCAAACAATGGCCAGGATGTTTCCGTTGTCACTTCCACACCCAACCGAGAGAGGCAGAAACTCATGAGGGAACAGAACATCCTAGCGCAGATCTTTGGCATCCTGAAGGCTCCATTCACAGATCAGGGTGACGGTCCGATGCTGAAGTTGGAGGATTTGGGAGACCAGCGCTATGCGCACTTCAAGTACATGTTGAGACTCTGCTACAGGGTGCTGCGCCACTCCCAACAGGACTATCGCAAGAACCAGGAAGCCAAGAAGTTCACCATCATGCAGTCTCAGATTGGCTATGAGATCCTGGCTGAGGACACAATCACTGCCCTGCTGCACAACAACCGCAAGCTGCTAGAAAAACACATCACAGCCAGAGAGATTGAGACCTTCGTCAGCCTGCTGAGGCGCAACAGAGAGCCCAGATTCCTGGATTATCTGTCTGATCTATGTGTATCCAACAAGACTGCGATCCCCGTCACACAGGAGCTTATCTGTAAATTTATGCTCAACCCCACCAATGCAGATATCCTCATCCAGACCAATCGCACTCCCTGTACCCCCCCCCAACCCAGGATCCCGAACACTGAGACCACCATATCTCTGTGGCTCTACTGGATCGACGGGCACATTCGCCACCTTGCCCAGGATGCCAAGGGCGATTCAGAGACCATCACCTATTACAGGTACCAGTTGAACCTTTTTGCAAAAATGTGTCTGGACCGCCAGTACCTAGCCATCAACCAGATCACCGGTCAGCTGCCTGTGGACCTGATCCTGCGCTGCATGTTCGACGACTGCCTGCCCTACAACCTCAGAGCCTCCTTCTGCCGTCTCATGCTGCATATGCACGTGGACCGCGACCCCCAGGAGGCCGTGGTGCCTGTACGCTACGCCCGCCTCTGGACTGAGATCCCGTCCAAGATCACCATCCACGAGTTTGAAGAGTCCGGTGACATTTCAAGAGAGGAGATGAAGAGGAAGTTCGCTCCCACCATGGAGTTTGTCGAAGAATATCTTAAAGATGTGGTCAACCAACCTTTTCCATTTGGAGAAAAAGACAAGAACGAACTCACGCTAGAGGTGGTGAATCTGGCTCGTAACCTGGTTTACTTTGGTTTCTATAGCTTTAGTGAGCTGCTGCGCCTCACGCGCACTCTGCTGGCCATACTGGATATTCACCCACTGACCTTCATGAACAAGCTCGACAAGAGCCCAGAGACTGGCAACAATGTCCTACGCACGATCCACGGAGTCGGGGAAATGATGACTCAGATCATGATGAGTCGAGGCGTGCCGCACAGCCTCCCTGACACCTCCACATCCCTCCGCTATGCGAGACTGCAGGACAATGAGGATGTCATGGTGATGGACACCAAGCTAAAGATCATCGAGATCCTGATCCTAAGTGTGAGGATCACAGGCTCTGAATTAAGTGCAGTGGAGCTGGACGATCAGGCCTTCCAGCTGTTGGTGTCCGAGCAGGATGTAGACAACTACATCAAGGCAGACCTGGACCAGCTACGCTTGAAGTCAGAGGTCAATGTGCAGAATGGAGACAATAAACCTCAAATTGACAGCAACAAAGCAAACAACTACAAAATAGTCAAAGAGATTCTGCTGAGACTCAGTAAGCTGTGTTATCCCAGTAAGAAGAGTCGCGTGCAGAGGCTGCTGAAGAACATGGGAGCCCACGCAGTGGTGCTGGACTTGCTGCAGATCCCCTATGAGAAGTGTGACGAGAAGATGAATGAAATCATGACCCTGGCACATACGTTTCTGCAGAATTTCTGCAAAGGAAATCATCAGAATCAACTTCTACATAAACACCTGAACCTCTTCCTCACTCCTGGGTTGCTTGAAGCTGAGACAATGATCTTTATGAACAACTACCAGCTGTGCAATGAGATCAGCGACCGCGTGGTCCACCATTTTGTCCACTGCATCGAGACACACGGAAGACACGTTCAATACCTCAAGTTCCTGCAAACCATTGTGAAAGAAGATGCAAAGTATGTGAAGAAATGTCAGGACAAAGTCATGACCGAGCTGGTGCTGGTGTTCTACAACGACCGCTCCTCGTTCTCCGTGTTGCTGCAGATGATGGGCTCCGAGCGCGAGATGGACGAGGACGGACTGGCGTACCACAACGCGCTCGTAGAGCTGCTGGCTGCCTGCACCGAGGGCTACACGGAGCTGAAATGCAACTCTCTTCTGCCGGACGACATCGTCAAAGTTGTCACAGATATTCACTGCATCCCAGAGGTGAAAACGGCTTATGTGAACTTTGTGAATCACTGTTACGTGGACACAGAGGTAGAAATGAAGGAGATCTACACCTCCAACCACATTTGGAAACTCTTTGACAACTTCCTGGTGGACATGTCCAGCGTTTGCAACTCTACCACGGACCGTAACGCCCTGGAGAAGTATGTGACGGAGACCGTGATGGCCATCGTCAAGGGTTTCTTCAGCTCACCTTTCTCTGTCAACCACTCCAACCTGCAGAGAAACCAGTTGGTCTTCATCAAGCTGCTCCAGTCTTCTTTCAGGATCTACAACTGCCCCTGGATCAACTCTGCTCAGAAAGTTAACATTGAGAACTGTATCAAAACGCTGGCAGACGTCGCCAAGGCCCGGGCCATAGCCATCCCCGTGGACCTGGACAGTCAGGTCAACACTTTGTCTCTGAGGGTCCATAACATGGTGCAGCGAGCAGCCAAGGACTGGAGGACATCCGCCCGCACACGACCCCGCAAGGAGAACCTGGGCGGCCCCGACTACAAGAACATCATTGAGAAGCTCCAGGGGGTCGTGTCCCTTCTGGAGGAACAGTTCAGTCCTAAAGTTCAGGCAGAGTTCTCTGTGCTGGTGGATGTTCTTCACAGCCCAGAACTGCTGTTTCCAGAGGCCGCTCGATTATGTGAGAGTGGAGCTTTCATGTCCAAACTGATCAAACACACCCAAAAACTTATGGAAAAAAAGCTGTGTATCAAGATCCTGCAAACACTCAGAGAGATGATGGACAAGAAGGAATGCTTCCAGGAGGGAAGCGACTTAAGAAAGCTCACTCGCTACTTTAAGACTGAGCTTGGAAGTGGAAACTGTTCATCTGTATCTAGTAGTTTGGTGGAGATCCAGTGTCTCCTGGACAATGTTGGCGCGTCAGAGCTGGTGATTCTCATCGTCAACACCAAGAACGACCGGGTGTTTGAGGAGAGCATTCTGTTGGGCATCGCCCTCCTCCAGGGCGGAAACACACAGATACAGAACTCCTTCTATAACCAACTCCGCAAGGAGAAGAAGTCCGAGAGATTCTTCAAGGTTTTCTACGACCGCATGATCCGAGCCACCGTGTCCGTCAACGAGCTCAGCTGCAGAAAAAGGGAGGACGACACCGACGTCAGTAGCATCCGGTTGAAGAAAGAGAGAGACTCTTTGCATATAAGGGAGGACATGCGAGGGCAGCTAAAGGAGGCCTCCTCAGTCACCTCAAAGGCCTTCTGCGCCTACAGAAAGGAGCTGGACCCCGACCTCGGGGCAGAAGATGCTTTGGAAGAAACTCCGATGAGCCACGCCATCACCATCATGAAACCAATCCTACGTTTCCTTCAGCTGCTGTGTGAGAACCACAATACAGACCTGCAGAGCTGCATAGCCAAGCATGAGTCAAACGGCATTGATATAATTATAGCTCTGATTGTGAACTCCATCAACCCCCTGGAGAAGCATCGACTGGACCTTGTGCTTGAGCTCAAGAACAATGCCTCCAAACTGCTACTGGCCATCATGGAGAGTCGCCATGACAGCGAGAACGCAGAGAAGATTCTCTACAAGATGAGACCCACCGAACTGGTGGATGTCATGAAGGAAGCCTATGCCCAAGGTATCGAGTGTGAGGACGAGGACAGTGTTGACCGGATAAAGCCCAGAGACGTCGGGCACAACATTTACATCCTGGCGCACCAGCTGGCCCGACACAATAAGATCCTGCAGCAGAGCCTGAATTGGGGTGTGGACCCCGACGAGGAGGACGAGGCGGTGCATTACTACGCCAATCACACGGCCCAGATCGAGATCGTGCGTCACGACCGCACCATGGAGCAGATCGTGTTTCCGGTCCCCAACATCTGCGAGTACCTCACGGAGGAGTCCATGGTGCGCGTGTTCACCACCACCGAGCGAGACGACCAGGGCAGCAAGGTTAACGACTTCTTCCAGCAGTTTGACAACCTCTACAACGAGATGAGGTGGCAGAAGAAGATCCGCAGAAATAAGGCCCTGTTCTGGTTCTCACGACACATCTCTGTTTGGGGGAGCATCTCCTTCTACCTAGCCTGTCTGCTCAACATCGCAGTGGCCGTATTCTACCCCTTT
a0009 CTAGTGGATGACAGATGTGTGGTGCATCCAGAAGCAGGCGATCTAGCCAACCCTCCCAAGAAATTCAGAGATTGCCTTTTCAAAGTGTGCCCTATGAACCGATATTCTGCACAGAAACAATACTGGAAGGCCAAGCAAGCCAAACAAGGAAACCACACAGAAGCAGCCTTGCTTAAGAAATTACAGCATGCTGCAGAACTGGAGCAAAAGCAGAATGAATCAGAGAACAGGAAGCTGTTGGGAGAAATTGTTAAATATAGTAATGTGATACAACTACTGCACATAAAAAGCAACAAATATCTGACAGTCAACAAGCGCCTCCCTGCCTTACTGGAGAAGAATGCCATGCGTGTGTCCTTGGATGTGGCAGGAAATGAAGGGTCTTGGTTTTATATTCATCCCTTTTGGAAACTGAGGAGTGAAGGTGACAATATTGTGGTAGGAGATAAAGTTGTGTTGATGCCAGTCAATGCTGGACAGCCACTACATGCAAGTAACATAGAGCTTCTAGACAACCCAGGATGTAAAGAGGTTAATGCTGTTAATTGTAACACTAGCTGGAAAATCACTTTATTCATGAAATACAGTTGCTACCGTGAAGATGTTCTCAAAGGGGGTGATGTTGTTAGATTGTTTCATGCAGAACAAGAAAAGTTTCTGACCTGTGATGAATATGAGAAAATACAATATATTTTTCTTCGTACAACTTTGCGTCAATCAGCTACATCTGCCACAAGTTCTAAAGCACTCTGGGAAATTGAGGTGGTGCACCATGATCCATGCCGTGGGGGAGCAGGACAGTGGAACAGCTTATTCCGATTCAAACATCTGGCAACTGGAAATTATTTAGCTGCAGAGAGAGATGACCTTCCTACTTCAAAGAAGAAACGCCAAGCAGAGAAGATTATGTATACTTTGGTCTCTGTACCAGGAAATGACATTGCATCACTCTTTGAATTAGATGCTACCACTCTTCAGAGAGCTGATTGCCTAGTGCCAAGGAATTCATATGTTCGGTTGAGACATTTGTGCACTAATACATGGGTAACCAGCACGAGTATCCCTATAGACACAGATGAAGAGAGACCTGTAATGCTGAAGATTGGAACTTGCCAAACAAAAGAAGATAAAGAAGCTTTTGCCATTGTGTCAGTTCCTCTCTCAGAAGTTCGGGATTTAGATTTTGCCAATGATGCAAACAAAGTCTTAGCATCCACAGTGAAAAAAATGGAGCATGGAGCAATAACTCAGAATGAAAGAAGATTTGTAACAAAGTTATTGGAAGATCTCATTTTCTTTGTTGCTGATGTTCCTAATAATGGACAAGATGTTGATGTGGTAATCACCAAGCCAAATCGGGAAAGGCAAAAATTAATGAGGGAGCAGAACATATTGGCACAAGTGTTTGGAATTCTTAAAGCTCCTTTTAAGGACAGAGGAGAAGGATCAATGCTGAGACTTGAAGATCTGGGGGACCAGAGATACGCTCCTTATAAGTACATGTTGAGGCTCTGTTATCGAGTTCTTAGACATTCTCAGCAGGACTATCGGAAAAACCAGGAAGCTAAGAACTTCTGTGTCATGCAATCCCAGATTGGTTATGATATTTTGGCAGAAGATACTATCACAGCTTTGTTGCACAACAACAGAAAACTACTAGAAAAACATATCACAGCTAAAGAAATTGAAACATTTGTTAATTTACTCCGGAGGAACCGGGAGCCAAGATTTTTGGATTATTTATCAGACTTGTGTGTATCTAATACCACTGCCATACCAGTGACTCAAGAACTCATCTGTAAATTTATGCTGAGCCCAGGAAATGCTGACATCCTCATTCAAACCAAGTTGGTTTCCCAAATACCTTTGGAGTGCTCCCTGTCAGATGATATTGATGATGAAGAAGTTTGGCTCTACTGGATTGACAGCAACATCCGGCATCTTGCACAAGAGGCTAAAGAAGATTTAGAAGTCCTCACCTATTACAGGTACCAATTGAACCTCTTTGCAAGGATGTGTTTGGATCGTCAATATCTGGCCATAAACCAGATTTCTACCCAGCTTTCAGTCGATTTGATCTTACGCTGTATGTCAGATGAAAGCCTGCCATATGACCTGCGAGCCTCTTTTTGCCGCCTTATGCTTCACATGCATGTGGACAGAGATCCCCAAGAATCAGTGGTCCCTGTTCGCTATGCAAGGCTTTGGACAGAAATACCTACCAAGATCACAATATACGAATATGATTCTATTACAGACTCTTCGAGAAATGATATGAAGAGGAAATTTGCACTGACAATGGAATTTGTTGAAGAATACTTGAAAGAGGTTGTAAACCAGCCATTTCCTTTTGGCGATAAAGAGAAAAACAAGCTTACATTTGAGGTGGTGCACTTGGCTCGAAATCTTATTTACTTTGGATTTTATAGTTTTAGTGAGTTGCTAAGACTGACAAGAACACTTCTGGCTATTCTGGATATTGGACCCATGTCATACCTTGAAAGATTAAGCAAATTTCAAGATGGAGGGAATAATGTAATGCGAACTATCCATGGTGTTGGAGAGATGATGACCCAAATGGTACTCAGTAGGGGATTTCCCATGTCTGTGCCTGATGTACAGCCCAATACTCATGCAATCAAAACTATTGATAATGAAGATGTAACTGTTATGGACACAAAACTAAAGATAATTGAAATTTTGATTCTGAGTGTTAGGATCTCAAGAAAAGAAAAAAATCCAGTACAACTTGATGATCAAGCTTTTCAGTTATTAGTATCTAATCAAGATGTAGACAACTACATCAAAGCTGACCTAGATCAACTACGACTGAAATCTGAGGTAAAAGTGCAAGATGGAACCAAGAAACCTCAAATTGACAGTAATAAGAGCAACAATTACAAGATTGTAAAGGAGATTTTAATCAGATTAAGTAAACTCTGTGTCCAGAATAAAAAGTGTCGAAATCAACGTTTGCTTAAAAACATGGGGGCTCATTCAGTGGTGTTGGATCTTCTACAGATACCCTATGAAAAGTCTGATGAAAAGATGAATGAAGTAATGAATTTAGCCCATACATTTCTACAGAATTTCTGTCGGGGAAATCCTCAGAATCAGCTTCTCCATAAACATCTCAATTTGTTTTTAACTCCTGGTCTTCTTGAAGCAGAAACAATGATCTTCATGAACAACTACCATCTGTGCAATGAGATTAGTGAGAGAGTCGTGCAGCACTTTGTACACTGTATTGAGACACATGGTCGCCATGTAGAATACCTGAGGTTTTTACAAACGATTGTAAAAGCAGATGGCAAATATGTGAAAAAATGCCAGGATATGGTAATGACAGAGTTAATACTGATATTTTACAATGATCGAGCATCATTTCCAATCCTTCTCCAAATGATGTGTTCTGAGAGAGACGGAGATGACAGTGGATTAGCCTACCATGTAACCCTTGTGGAATTATTGGCAGCATGTACTGAGGGCTATACTGAAATCAAGTGCAACTCTCTTCTGCCTGATGATATAGTGAGAGTAGTAGCCCATGATGACTGTATTCCTGAGGTTAAGATCGCATATGTGAATTTTGTTAATCACTGTTATGTGGATACTGAAGTGGAAATGAAAGAAATCTATACTAGTAATCACATTTGGAAATTATTTGAAAACTTTCTTGTTGATATGGCAAGGGTTTGCAATACAACTACAGATAGGAAATTTTTAGAGAAGTGTGTAACAGAGCCAATAATGAATATTGTTAGTGGCTTCTTTAATTCTCCCTTCTCAGACAATAGCACAAGCCTTCAGACTCACCAACCAGTTTTTATTCAACTCCTTCAGTCTGCCTTTAGAATTTACAACTGTACCTGGTTAAACCCAATACAAAAAGCCTCAGTGGAGTCATGTATCAAAACATTGGCTGAAGTGGCAAAGAATCGTGGCATTGCAATTCCAGTGGATTTAGACAGCCAAGTCAATACTCTGTTCATGAAGAGCCATAATATGGTACAGAGAGCGGCCATGGGATGGAGAATGTCAGCTCGTAGTGGACCACGCAAAGAGGCTCTTGGAGGGCCTGATTATAGGAACATAATTGAAAAGTTGCAGGATGTAGTGGGTTCTTTAGAGCAGCAGTTCAGCCCCATGATGCAGGCTGAATTCTCAGTGTTGGTTGATGTGCTATACAGCCCCGAACTTCTGTTTCCTGAGGGAAGTGACGCAATAAGATGTGGTGCTTTCATGTCCAAGTTGATTAATCATACAAAGAAGCTCATGGAGAAAAAGCTCTGCATTAAAATTCTTCAGACATTAAGAGAAATGCTAGAGAAGAAAGATAGCTTTGTGGAAGGGAGCACATTGAGGAAATTAAATCGTTATTTTAAAGGTGATTATGGGACTGGTTCATGCATATTTGCTCTGATATCAGTATCTGATATTCAGTGTCTTCTGGATAAAGAAGGTGCATCTGAACTTGTCATAGTTATAGTGAACACCAAAAATGATAAGATTTTTTCTGAAGGGATTTTGCTTGGCATTGCATTGCTTGAAGGAGGAAATACTCAAACACAGTATTCATCTTACCAGCAACTGCATGAACAAAAAAAATCTGAAAAGTTCTTTAAAGTCTTATATGATCATATGATACGATCAACTGTGACGGTGAATGACTTAGGCAGCAAGAAGAAGGATGATGATAATGATCTGATAGCAACAAGTCCAAGAAGAGTAAGAGATCCATTGCATTTAAAAGAGGGAATGAAAGGGCAGTTAACAGAAGCATCTTCAGCAACATCCAAAGCATACTGTGTTTATAGAAGAGAAATGGATCCAGAAATAAATACAGATGAATCTGCTGATGAAGTAACAATGAGTCCTACTATTGCAATCATGCAACCAATTCTGAGATTTCTTCAACTTCTTTGTGAGAATCACAACCGAGAACTACAGACTTGTATTGCTACCCATGAATCTAATGGCATTGATATCATTATTGCACTGATACTGAATGATATAAACCCTCTTGGTAAATATCGAATGGATCTGGTGCTTCAGCTCAAGAACAATGCCTCTAAGCTTTTGCTGGCAATTATGGAAAGCAGACATGACAGTGAGAATGCTGAGAGAATTCTTTTTAACATGAGACCAAGGGAACTGGTGGATGTCATGAAGAATGCCTATAATCAGGGTGTAGAATGTGATCATGATGATCGTGGAGACAGTATTTCACCTAAAGATGTTGGACACAATATCTATATTCTTGCCCACCAGCTGGCTCGCCATAATAAAGCATTACAGCAGATGCTTAAACCAGGGTCCGATCCAGAAGAAGGAGATGAAGCTTTAAAGTACTATGCTAACCATACAGCACAAATTGAAATTGTTCGTCATGATAGAACTATGGAACAGATTGTTTTTCCTGTTCCAAATATATGTGAATACCTCACTCGAGAATCCAAAAGTCGTGTATTCAACACAACTGAGAGAGATGAACAAGGAAGCAAAGTGAATGACTTTTTCCAACAGACTGAGGATCTTTACAATGAAATGAAATGGCAGAAAAAAATCAGGAATAATCCTGCACTGTTCTGGTTCTCTAGACACATATCTCTCTGGGGAAGCATTTCATTCAATTTGGCTGTGTTCATCAATTTAGCGGTTGCTCTTTTCTATCCATTC
a0011 CTGGTGGATGACCGATGTGTGGTGCACCCAGAAGCAGGGGACCTTGCCAACCCTCCCAAGAAGTTCCGAGACTGCCTCTTTAAGGTGTGCCCTATGAACCGATATTCTGCTCAGAAGCAATATTGGAAAGCCAAGCAAGCTAAACAAGGGAACCACACAGAGGCGGCCTTGCTGAAGAAATTACAGCATGCTGCAGAACTGGAACAAAAACAAAATGAATCAGAGAATAAGAAGCTATTGGGAGAAATTGTGAAATACAGTAATGTTATACAACTACTGCATATAAAAAGCAACAAGTATCTGACTGTCAACAAGAGATTACCTGCTTTACTGGAGAAGAATGCCATGCGCGTGTCCTTGGATGCTGCGGGAAATGAAGGGTCTTGGTTTTATATTCATCCCTTCTGGAAGCTGAGAAGCGAGGGCGACAATATTGTTGTTGGAGATAAAGTTGTTTTGATGCCCGTGAATGCAGGACAGCCACTACATGCCAGCAACATTGAACTACTCGATAATCCAGGGTGTAAAGAGGTGAATGCTGTTAATTGCAACACTAGCTGGAAAATCACTTTATTCATGAAATACAGTTCCTATCGAGAAGATGTACTAAAAGGAGGTGATGTTGTTCGCTTGTTCCATGCGGAACAAGAGAAGTTTCTGACTTGTGATGAATATGAGAAAAAGCAGCACATTTTCCTTCGTACAACCTTGCGTCAATCAGCCACTTCTGCAACCAGCTCTAAAGCACTCTGGGAAATAGAGGTAGTTCATCATGATCCATGCCGTGGGGGTGCAGGACAGTGGAACAGCTTGTTCAGATTTAAACATCTTGCAACTGGGAACTATTTAGCTGCAGAGAGAGATGATCTTCCAGCTTCAAAGAAGAAACGCCAGGCAGAGAAGATCATGTACACTTTGGTCTCAGTCCCGGGAAATGACATTGCGTCGCTTTTCGAACTGGATGCCACGACTCTTCAGAGAGCAGACTGCCTGGTTCCAAGGAACTCATATGTGCGGTTAAGACATCTATGTACAAACACATGGGTAACCAGTACTAGCATCCCCATAGACACGGATGAAGAGAGGCCTGTTATGTTGAAGATTGGAACTTGCCAGACAAAAGAAGATAAAGAAGCATTTGCCATTGTGTCTGTCCCACTGTCCGAGGTCCGAGATTTAGACTTTGCCAATGATGCAAATAAAGTGCTGGCGACTACAGTTAAAAAGCTGGAAAATGGCACAATAACCCAGAATGAAAGGAGGTTAAAAAAAAAAACAAACCCAATACTTCTAAAAAGAAAATGCGATATATTTATGCTTGGACTGGACTTAGATGGCTTGCTCTTGTCTCTCTTTGCAGAACGTCAGAAGTTAATGAGGGAACAGAACATATTGGCACAGGTATTTGGGATTCTTAAAGCACCCTTTAAGGAGAAAGGAGAAGGCTCAATGTTGAGACTGGAAGATCTGGGGGATCAAAGATATGCCCCCTATAAGTACATGCTGAGGCTGTGCTACCGTGTGCTGAGACATTCGCAGCAGGACTACCGGAAAAATCAGGAAGCTAAGAATTTCTGTGTCATGCAGTCCCAGATTGGCTATGATATTTTGGCAGAAGATACCATCACAGCTTTGTTGCACAACAACAGAAAACTACTAGAGAAACACATTACAGCAAAAGAAATAGAAACATTTGTTAGTTTACTCAGGAGAAATCGAGAGCCAAGGTTTTTGGATTATTTATCAGATCTGTGTGTGTCTAATACCACCGCGATACCCGTAACTCAAGAACTCATCTGCAAATTTATGTTGAGCCCGGGCAATGCAGACATTCTCATTCAAACCAAACTGGTCTCACAAGGACCCATGGAGAGTGCCCTTTCAGATGACATTGATGAGGAAGAAGTTTGGCTCTACTGGATTGACAGCAACATCAGGCACCTTGCCCAGGAGGCAAAGGAGGATTTGGAAGTCCTTACCTATTACAGGTACCAGCTAAATCTCTTTGCAAGAATGTGCTTGGATCGCCAGTATCTGGCCATAAACCAGATTTCTACACAGCTCTCTGTTGATTTGATCCTGCGATGTATGTCAGATGAGAGCCTGCCTTTTGACCTCCGAGCATCCTTTTGTCGCCTCATGCTCCACATGCATGTTGACCGGGATCCCCAGGAGTCCGTAGTGCCTGTTCGCTATGCCCGGCTCTGGACAGAAATCCCCACGAAGATCACAATTCATGAGTATACCAGGAGACTACAATGTCTTAGAAGCCAAATAAAAAGTAATTTTAATTGTTTGTTGGCTTATATAATGTACTTCCTAGATAGCACCTGTTCATTGGAGTTTTTTTTTTTTTTTTCAATTTATTACAGATTCCGTTTCACTTCTAGTGATTGGTCTATTCAAATCATCTATTTCTTCTTGATTCAGTTTTGTGCTCTCCCTGCCACATTTTCAGTCTGGTTGCAGCCAACGGCTATAGTCTCCCAAGGCATGTGTGTTGACCTGTGGGCTTTTCTTGTGCCAGGAAACAATGTCATGAGAACCATCCATGGGGTGGGAGAGATGATGACCCAGATGGTGCTCAGCAGAGGCTTCCCCATGAGTGTGCCTGACATTCAGCCCAGCCTGCACCCCAGCAAGCCCACTGACCACGAGGACGTCACCGTCATGGACACCAAGCTGAAGATCATTGAGATTTTAATCTTGAGTGTCAGGATCTCCAGAAAGGAGAAAAATCCAGTTCAACTTGATGACCAGGCATTTCAGTTGCTGGTGTCTAATCAGGATGTAGATAACTACATCAAGGCAGATTTAGACCAGCTTCGACTTAAATCGGAGGTAAAAGTGCAAGATGGAACAAAGAAACCTCAGATTGACAGCAATAAGAGCAACAACTATCGGATTGTAAAGGAGATTTTGATTAGGCTCAGTAAACTCTGCGTCCAGAACAAAAAGTGTCGCAATCAACGATTATTGAAAAATATGGGAGCCCATTCGGTGGTGTTGGATCTGCTGCAGATACCCTATGAAAAGAATGATGAGAAGATGAACGAAGTAATGAATCTGGCTCACACATTCCTGCAGAATTTCTGTCGGGGGAATCCACAGAATCAACTCCTCCATAAACATCTGAATTTGTTCTTAACCCCTGGTCTCCTTGAAGCAGAAACTATGATCTTCATGAACAATTACCATCTGTGCAATGAAATTAGTGAGAGAGTTGTCCAGCACTTCGTGCACTGCATTGAGACACACGGCCGCCACGTGGAGTACCTGAGGTTTCTGCAGACAATTGTCAAAGCAGATGGTAAATACGTGAAGAAATGCCAGGATATGGTAATGACCGAGTTGATACTGATATTTTACAATGATAGAGCATCATTTCCCATCCTTCTCCATATGATGTGTTCAGAGAGAGACGGGGATGAGAGTGGCTTAGCCTACCACATCACCCTCGTGGAGTTGCTGGCAGCATGCACAGAGGGGTACACTGAAATCAAGTGCAATTCCCTTCTGCCCGACGACATAGTGAGGGTGGTGACCCATGATGACTGCATCCCTGAGGTTAAAATTGCTTATGTGAATTTTGTTAATCACTGTTACGTGGACACAGAAGTGGAAATGAAAGAAATCTACACAAGTAACCACATTTGGAAATTATTTGAGAACTTCTTGGTGGATATGGCAAGGGTTTGCAACACAACCACAGACAGGAAGTTTTTGGAGAAGTGTGTTACTGAGTCAATAATGAACATTGTGAGCGGCTTCTTTAATTCACCCTTTTCAGACAACAGTACCAGCCTCCAGACACATCAGCCAGTTTTTATTCAGCTGCTCCAGTCTGCCTTCAGAATTTATAATTGCACCTGGCCAAATCCAGCCCAGAAAGCCTCAGTGGAGTCCTGTATCAGAACTTTGGCTGAAGTGGCAAAGAATCGTGGAATTGCCATTCCAGTGGATTTGGACAGCCAAGTGAATACTCTTTTCTTGAAGAGTCATAATATGGTGCAGAGAGCGGCCATGGGCTGGAGACTATCAGCTCGCTCTGGACCACGCAAGGAAGCTCTTGGAGGGCCTGATTACAGAAATATTATTGAAAAGTTACAGGATGTAGTGGCCTCCTTGGAGCAACAATTCAGCCCGATGATGCAGGCTGAATTCTCAGTGTTGGTTGATGTGTTGTACAGCCCAGAACTGCTGTTTCCCGAGGGAAGTGATGCGATAAGATGTGGCGCTTTCATGTCGAAGTTGATTAATCATACAAAGAAACTGATGGAAAAAAAATTGTGCATTAAAATTCTTCAGACTTTACGAGAAATGCTAGAGAAGAAAGACAGCTTTGTGGAATTGAACAAAGTAGAATGGTTTCACAAATCATTTTCAAGTGATTACGGAGTCTCTAATTGCAAAACTGCACAAATATCCATGTCAGATATTCAGTGTCTCCTGGATAAAGAAGGTGCATCTGAACTTGTCATCGTTATAGTGAATACCAAAAATGACAGAATTTTTTCAGAAGGCATCTTACTTGGCATTGCCTTGCTGGAAGGAGGAAACACACAAACTCAGTATTCCTTCTACCAGCAGTTACATGAACAAAAAAAATCAGAAAAATTCTTCAAAGTTCTCTACGACCGAATGATAAGATCAACAGTGACAGTTAACGACTTAGGTAACAAGAAAAGGGATGATGACACAGAACTGATGACATCTGGCCCACGGAGAGTAAGGGATTCATTACATTTAAAAGAGGGAATGAAAGGGCAGTTAACAGAAGCTTCTTCGGCCACATCCAAAGCATACTGTGTATACAGAAGAGAAATGGATCCAGAAATAAATGCCGAGGACTCCACCGAGGAAGTCACAATGAGCCCTGCCATTGCCATCATGCAGCCGATTTTGAGGTTTCTGCAGTTACTCTGTGAGAATCATAACCGGGAGCTGCAGACATGTATTGCTACTCATGAATCTAATGGAATTGATATCATCATTGCTTTGATTCTAAATGACATAAACCCTCTTGGTAAATATCGAATGGACCTGGTGCTCCAACTAAAGAACAATGCTTCCAAGCTTTTGCTGGCCATCATGGAAAGCAGACATGACAGCGAGAATGCAGAAAGGATTCTTTTCAACATGAGACCCAGAGAACTGGTGGATGTGATGAAGAATGCCTATAATCAAGGATTGGAATGCGATCATGATGATGAGGGCGATGATGTTTCCCCAAAGGATGTTGGACACAATATCTATATCCTGGCCCATCAGTTGGCCCGCCACAACAAACTTTTACAGCAGATGCTCAAACCAGGATCCGATCCAGATGATGGCGATGAAGCCTTGAAGTATTATGCCAACCATACTGCACAGATCGAGATTGTTCGACATGACAGGACAATGGAACAAATAGTATTTCCTGTCCCCAATATATGTGAATACCTCACGCGAGAATCCAAGTGTCGCGTATTCAACACCACGGAGAGGGATGAACAGGGAAGTAAAGTGAATGACTTTTTCCAGCAAACTGAAGATCTCTACAATGAGATGAAGTGGCAGAAGAAAATCAGGAGTAATCCTGCCCTGTTCTGGTTCTCAAGGCATATTTCTCTTTGGGGGAGCATCTCCTTCAACCTGGCTGTGTTCATCAACTTAGCTGTGGCTCTCTTCTACCCATTT
a0000 TTAGTGGATGACAGATGTGTGGTGCACCCAGAGGCAGGAGACCTTGCCAACCCTCCCAAGAAATTCAGGGACTGCCTCTTTAAGGTGTGCCCTATGAACCGATATTCTGCCCAGAAACAATATTGGAAAGCTAAGCAAGCCAAACAGGGGAATCACACAGAGGCAGCCTTGCTGAAGAAATTACAGCATGCTGCAGAACTGGAACAAAAACAAAATGAATCAGAGAATAAGAAACTGTTGGGAGAAATTGTGAAATACAGCAATGTCATACAACTGCTGCATATAAAAAGCAACAAGTATCTGACTGTCAACAAGAGATTACCTGCTTTGCTGGAGAAGAATGCTATGCGTGTGTCCCTGGATGCTGCAGGAAATGAAGGGTCTTGGTTTTATATTCATCCCTTTTGGAAGCTGAGAAGCGAGGGTGACAATATCGTTGTGGGTGATAAAGTTGTTTTGATGCCTGTGAATGCAGGACAGCCACTACATGCCAGCAACATAGAGCTTCTCGATAATCCAGGGTGTAAAGAGGTGAATGCTGTTAATTGCAACACTAGTTGGAAAATAACTTTATTCATGAAATATAGTTCCTATCGAGAGGATGTACTAAAAGGAGGTGATGTTGTTAGGTTGTTCCATGCAGAACAAGAGAAGTTTCTGACTTGTGATGAATATGAGAAAAAACAGCACATTTTCCTTCGGACAACCTTGCGTCAATCAGCCACTTCTGCTACCAGTTCTAAAGCGCTCTGGGAAATAGAGGTAGTTCATCATGACCCATGCCGCGGGGGTGCTGGACAATGGAACAGCTTGTTCAGATTTAAGCACCTTGCAACTGGGAACTATTTAGCTGCAGAGAGAGATGATCTTCCAACTTCAAAGAAGAAACGCCAGGCGGAGAAGATCATGTATACTTTAGTCTCAGTCCCAGGAAATGACATTGCATCCCTTTTTGAACTGGATGCCACAACTCTTCAGAGAGCTGACTGCCTGGTTCCAAGGAACTCATATGTTCGGTTGAGGCATTTATGTACCAACACGTGGGTAACAAGTACTAGTATCCCCATAGACACAGATGAAGAGAGACCTGTTATGTTGAAGATTGGAACTTGCCAAACAAAAGAAGATAAAGAAGCATTTGCCATTGTGTCTGTCCCGTTGTCTGAGGTCCGAGACTTAGACTTTGCCAATGATGCAAATAAAGTGCTGGCAACCACAGTTAAAAAGCTGGAAAATGGCACAATAACTCAGAATGAAAGGAGGTTTGTAACCAAATTATTAGAAGATCTCATCTTCTTTGTGGCTGATGTACTTAATAATGGACAAGAAGTTGATGTGGTTATCACTAAGCCAAACCGAGAACGTCAAAAATTAATGAGGGAACAAAACATATTGGCACAGGTATTTGGAATTCTTAAAGCACCCTTTAAGGAGAAGGGAGAAGGCTCAATGCTGAGACTTGAAGATCTGGGGGACCAAAGATATGCTCCTTACAAGTATATGCTGAGGCTGTGTTACCGTGTGCTGAGACATTCACAGCAAGACTACCGGAAAAATCAGGAAGCTAAGAATTTCTGTGTCATGCAGTCCCAGATTGGCTATGATATTTTGGCAGAAGATACCATCACAGCTTTGTTGCACAACAACAGAAAACTACTAGAGAAACATATCACAGCAAAAGAAATAGAAACATTTGTCAGTTTACTCAGGAGAAATCGTGAGCCAAGGTTTTTGGATTATTTATCAGATCTGTGTGTGTCCAATACCACTGCTATACCTGTAACTCAAGAACTCATCTGTAAATTTATGTTGAGCCCAGGCAATGCGGACATTCTCATTCAAACTAAAGACAATTTCTATTTGTTATTTGATCTTAACCTACCCCAAAAATTTGACTCCAGTAACACTTGGAAATATTGGTGTCCTATAAAAGTAAATAAACTTTATCAAGAGAAGACAAATAATGTAATATGTTTCATATTTTTAAGGTACCAGCTAAATCTCTTTGCAAGGATGTGCTTGGATCGCCAATATCTGGCCATAAATCAGATTTCTACACAGCTCTCTGTTGATTTGATCCTGCGGTGTGTGTCGGATGAGAGCCTGCCATTTGACCTCCGAGCATCTTTTTGCCGCCTCATGCTCCACATGCATGTTGACCGGGATCCTCAGGAGTCTGTGGTGCCTGTCCGCTATGCCAGGCTCTGGACCGAAATCCCTACAAAGATCACAATTCATGAATATGATTCTATAACAGACTCTTCCAGAAATGATATGAAGAGGAAATTTGCACTGACAATGGAATTTGTTGAAGAATACTTGAAAGAAGTTGTAAATCAGCCCTTTCCTTTTGGGGATAAAGAAAAAAACAAACTGACATTTGAGGTGGTCCACTTGGCTCGGAATCTTATATACTTTGGATTTTATAGTTTCAGTGAATTGTTGAGACTAACAAGAACACTTCTGGCTATCCTAGATATCGCCCCCATGTCGTATTTTGAGAGATTAAGCAAATTTCAAGATGGAGGAAACAATGTCATGAGAACCATCCATGGGGTGGGAGAGATGATGACCCAAATGGTACTCAGTAGAGGCTTCCCCATGAGTGTACCTGACATTCAGCCCAGCATCCACCCCAGCAAGCCCGTAGAGCATGAAGACGTGACCGTGATGGACACCAAACTGAAGATTATTGAGATTTTAATCCTGAGTGTCAGGATCTCACTAAAGGAAAAAAATCCAGTTCAACTTGATGATCAGGCATTTCAATTGCTGGTGTCCAATCAAGATGTAGATAACTACATCAAGGCAGATCTAGACCAGCTTCGACTAAAATCTGAGGTAAAAGTGCAGGATGGAACAAGGAAACCTCAGATTGACAGCAATAAAAGCAATAACTACCGGATTGTAAAGGAGATTTTGATTAGACTAAGTAAACTCTGTGTACAGAATAAAAAGTGTCGGAATCAACGATTACTGAAAAACATGGGAGCTCATTCGGTGGTATTGGATCTTCTGAAGATTCCCTATGAAAAGAACGATGAAAAGATGAACGAAGTGATGAATCTGGCCCACACATTCCTGCAGAATTTCTGTCGAGGAAATCCCCAGAACCAACTCCTTCATAAACATCTGAATTTGTTTCTAACTCCTGGTCTCCTTGAAGCAGAAACCATGATCTTCATGAACAATTACCATCTCTGCAATGAGATCAGCGAGAGAGTGGTGCAGCACTTTGTGCACTGCATCGAAACACACGGTCGCCATGTGGAGTACCTGAGGTTCTTGCAAACGATTGTAAAAGCAGATGGCAAATATGTGAAGAAATGCCAGGATATGGTAATGACAGAGTTGATACTGATATTTTACAATGATAGAGCATCATTTCCCATCCTTCTCCATATGATGTGTTCAGAGAGAGACGGGGATGAGAGTGGCTTAGCCTACCACATCACCCTGGTGGAGTTGCTGGCAGCATGCACAGAGGGGTACACTGAAATTAAGTGCAATTCCCTTCTGCCCGATGACATAGTGAGGGTGGTGACCCATGATGACTGCATCCCTGAGGTTAAAATTGCATATGTGAATTTTGTTAACCACTGTTACGTGGACACTGAAGTGGAAATGAAAGAAATCTACACAAGTAACCACATTTGGAAATTATTTGAGAACTTCTTGGTGGACATGGCAAGGGTTTGCAACACAACCACAGATAGGAAATTCTTGGAGAAGTGTGTTACAGAGTCAATAATGAATATTGTGAGCGGCTTCTTTAATTCCCCCTTTTCAGACAACAGTACCAGCCTCCAGACACATCAGCCAGTTTTTATTCAGTTGCTGCAATCTGCCTTCAGAATTTACAATTGCACCTGGCCAAATCCAGCACAGAAATCCTCCGTGGAGTCTTGTATCAGAACTTTGGCTGAAGTGGCAAAGAATCGTGGGATTGCCATTCCAGTGGATTTGGACAGTCAAGTTAATACTCTTTTCCTGAAGAGCCATAATATGGTGCAGAGAGCAGCCATGGGTTGGAGACTATCAGCTCGCTCTGGACCACGCAAGGAAGCTCTTGGAGGGCCTGATTACAGAAATATTATTGAAAAGTTACAGGATGTAGTGGCCTCCTTGGAGCAACAGTTCAGCCCGATGATGCAGGCTGAATTCTCAGTGTTGGTTGATGTGTTGTACAGCCCAGAACTACTGTTCCCTGAGGGGAGTGATGCAATAAGATGTGGCGCTTTCATGTCCAAGTTGATTAATCATACAAAGAAACTAATGGAGAAAAAGCTGTGCATTAAAATTCTTCAGACTTTACGAGAAATGCTAGAGAAGAAAGACAGCTTTGTGGAAGGTAACACTTTAAGAAAACTGAATCGCTACTTTAAAGGAGACTATGGAGTTGGTAATTGCAAATCTGCACAAATATCAATGTCAGATATTCAGTGTCTACTGGATAAAGAAGGTGCATCTGAACTTGTCATCGTTATAGTGAACACCAAAAATGACAGAATTTTTTCAGAAGGCATTTTGCTTGGCATTGCCTTGCTTGAAGGAGGAAATACACAGACTCAGTATTCCTTCTACCAGCAGTTGCATGAACAAAAAAAATCAGAAAAATTCTTCAAAGTTCTCTATGACCGAATGATAAGATCAACAGTAACAGTTAATGACTTAGGTAACAAAAAAAGGGATGATGACAATGAATTGATGACAGCTGGTCCACGAAGAGTAAGAGACTCATTACTTTTGAAAGAGGGAATGAAAGGGCAATTAACAGAAGCTTCTTCCGCAACATCCAAAGCATATTGTGCATACCGAAGGGAAATGGATCCAGAAATACACGCCGAGGAATCTGCAGAGGAAGTAACGATGAGCCCTGCAATTGCCATCATGCAGCCCATACTGAGGTTTCTTCAGTTGCTGTGTGAGAATCACAACCGAGAACTGCAGACGTGTATTGCTACTCATGAATCAAATGGGATTGATATCATCATTGCTTTGATTCTAAATGACATAAACCCTCTTGGTAAATATCGAATGGATCTGGTGCTCCAGCTGAAGAACAATGCCTCTAAGCTTTTGTTGGCTATTATGGAAAGCAGACATGACAGCGAGAATGCGGAAAGAATTCTTTTTAACATGAGACCCAGGGAACTGGTGGATGTGATGAAGAATGCCTATAACCAAGGATTGGAATGTGACCATGATGACGAGGGTGATGGTGTTTCCCCAAAAGACGTTGGACACAATATCTATATTCTGGCCCATCAGTTGGCCCGTCACAACAAACTCTTACAGCAGATGCTCAAACCAGGATCGGATCCAGATGATGGGGATGAAGCCTTAAAATATTATGCCAACCACACTGCACAGATAGAGATTGTTCGGCATGATAGGACAATGGAACAGATAGTTTTTCCTGTCCCCAATATATGTGAATACCTCACTCGAGAATCCAAGTTCCGTGTGTTCAATACAACTGAAAGGGATGAACAAGGAAGTAAAGTGAATGACTTTTTCCAGCAAACAGAAGATCTCTACAATGAAATGAAGTGGCAGAAGAAAATCAGGAATAACCCTGCACTGTTCTGGTTCTCAAGGCACATATCCCTCTGGGGGAGCATATCCTTCAACTTGGCTGTGTTCATCAACTTAGCTGTTGCTCTTTTCTACCCATTT
a0002 TTAGTGGATGACAGATGTGTGGTGCACCCAGAGGCCGGGGACCTTGCCAACCCTCCCAAGAAGTTCAGAGACTGCCTTTTCAAGGTGTGCCCTATGAACAGATATTCTGCCCAGAAGCAATATTGGAAAGCAAAGCAAGCCAAACAAGGGAACCACACCGAGGCAGCCTTGCTGAAGAAACTACAGCACGCTGCAGAACTGGAACAAAAACAAAATGAATCGGAGAATAAGAAACTGTTGGGAGAAATTGTAAAATACAGTAATGTTATACAACTACTGCATATAAAAAGCAACAAATATCTTACTGTCAACAAGAGATTACCTGCTTTACTGGAGAAGAATGCCATGCGTGTGTCCTTGGATGCTGCAGGAAATGAAGGGTCTTGGTTTTATATTCATCCGTTCTGGAAACTGAGAAGCGAGGGTGACAATATTGTTGTAGGAGATAAAGTTGTTTTGATGCCTGTGAATGCAGGGCAGCCACTACATGCCAGCAACATAGAGCTTCTTGATAACCCAGGGTGTAAAGAGGTGAATGCTGTCAATTGCAACACCAGCTGGAAAATCACTTTATTCATGAAATATAGTTCCTATCGAGAGGATGTATTAAAAGGAGGGGACGTTGTTAGATTATTTCATGCGGAACAAGAGAAGTTTTTGACTTGTGATGAATATGAGAAAAAACAGCACATTTTCCTTCGTACGACCTTGCGCCAATCAGCTACTTCTGCTACTAGTTCTAAAGCACTCTGGGAAATAGAGGTGGTTCATCATGACCCATGCCGTGGGGGTGCAGGACAGTGGAACAGCTTGTTCAGATTTAAGCATCTTGCAACTGGAAACTATTTAGCTGCAGAGAGAGATGTCCCTCCAACTTCAAAGAAAAAACGCCAGGCAGAGAAGATCATGTATACTTTGGTTTCAGTCCCGGGCAATGACATTGCATCCCTTTTTGAACTAGATGCCACAACTCTTCAGAGAGCTGACTGCCTGGTTCCAAGGAACTCATATGTTCGGTTAAGGCATTTATGCACCAACACATGGGTAACCAGTACTAGTATCCCCATAGACACAGATGAAGAGAGGCCTGTTATGTTAAAGATTGGAACCTGCCAAACCAAAGAAGATAAAGAAGCGTTCGCAATCGTGTCTGTTCCACTGTCTGAAGTTCGAGACTTAGACTTTGCCAATGATGCCAATAAAGTACTAGCGACCACAGTTAAAAAGCTAGAAAACGGCACAATAACTCAGAATGAAAGGAGGTTTGTAACCAAATTATTGGAAGATCTCATATTCTTTGTTGCTGATGTGCCTAATAATGGACAAGAAGTTGATGTGGTTATCACTAAGCCAAACCGAGAGCGTCAAAAATTGATGAGGGAACAAAACATACTGGCACAGGTATTTGGAATTCTTAAAGCACCCTTTAAAGAGAAAGGAGAAGGCTCGATGCTGAGACTTGAAGATCTGGGGGATCAAAGATATGCACCCTACAAGTACATGCTGCGGCTCTGTTACCGCGTCCTGAGACACTCGCAGCAGGATTACCGGAAAAATCAGGAAGCTAAGAATTTCTGTGTCATGCAGTCCCAGATTGGCTATGATATTTTGGCAGAAGATACTATCACAGCTTTGTTGCACAACAACAGAAAACTACTAGAGAAACATATCACAGCAAAAGAAATAGAAACATTTGTCAGTTTACTCAGGAGAAATCGGGAGCCAAGGTTTTTGGATTATTTGTCAGATCTGTGTGTGTCTAATACCACTGCTATCCCTGTAACTCAAGAACTCATCTGTAAATTTATGTTGAGTCCAGGCAATGCAGACATTCTCATTCAAACTAAGGTGGTCTCACAAGCACCCATGGAGAGCTCCCTTTCAGATGACATTGATGATGAAGAAGTTTGGCTCTATTGGATTGACAGCAACATCAGGCACCTTGCTCAAGAGGCAAAAGAAGACTTAGAAGTTCTTACCTATTACAGGTACCAGCTAAACCTCTTTGCAAGGATGTGCTTGGATCGCCAGTATCTGGCCATAAACCAGATTTCTACACAGCTGTCTGTAGACCTGATCCTGCGGTGTGTGTCGGATGAGAGCCTGCCGTTCGACCTCCGAGCGTCCTTCTGTCGCCTCATGCTCCACATGCACGTTGACCGGGATCCCCAGGAGTCCGTGGTGCCTGTTCGCTATGCCAGGCTCTGGACAGAAATCCCCACAAAGATCACAATTCATGAATATGATTCTATAACAGACTCTTCCAGAAATGATATGAAGAGGAAATTTGCCCTGACAATGGAATTTGTTGAAGAATATTTGAAAGAAGTTGTAAACCAGCCCTTTCCTTTTGGGGATAAAGAAAAAAATAAACTGACATTTGAGGTGGTCCACTTGGCTCGGAATCTTATATACTTTGGATTTTATAGTTTCAGTGAGTTATTAAGGCTAACAAGAACACTTCTGGCTATTTTAGACATTGCCCCCATGTCATACTTTGAAAGATTAAGCAAATTTCAAGATGGAGGAAACAATGTGATGAGAACCATTCATGGGGTGGGAGAGATGATGACCCAGATGGTACTCAGTAGAGGCTTCCCCATGAGCGTGCCGGATGTGCCACCCAGCATCCACCCGAGCAAGCCCACCGAGCACGAGGATGTGACTGTGATGGACACCAAGCTGAAGATCATTGAGATTTTGATCCTGAGTGTCAGGATCTCAAGAAAAGAAAAAAATCCAGTTCAACTTGACGATCAGGCATTTCAATTACTGGTGTCTAATCAAGACGTAGATAACTACATCAAGGCAGATCTAGACCAGCTTCGACTGAAGTCTGAGGTGAAAGTGCAGGATGGAACAAAGAAACCTCAGATTGACAGCAACAAGAGCAATAACTACCGGATTGTAAAGGAGATTTTGATCAGGCTAAGTAAACTCTGTGTGCAGAATAAAAAGTGTCGGAATCAACGATTACTGAAAAATATGGGGGCGCATTCGGTGGTGTTGGATCTTCTGCAGATACCCTATGAAAAGAATGATGAAAAGATGAATGAAGTAATGAATCTAGCCCATACATTTCTGCAGAATTTCTGTCGAGGAAATCCACAGAATCAACTTCTTCATAAACATCTGAATTTGTTTTTAACTCCAGGTCTCCTTGAAGCAGAAACCATGATCTTCATGAACAATTACCATCTGTGCAACGAAATTAGCGAGAGAGTTGTACAACACTTTGTGCACTGCATTGAGACACATGGCCGCCACGTGGAGTACCTGAGGTTTTTGCAAACAATTGTAAAAGCAGATGGTAAATATGTGAAGAAATGCCAGGATATGGTAATGACAGAGTTGATACTGATATTTTACAATGATAGAGCATCATTTCCAATCCTTCTCCATATGATGTGTTCAGAGAGAGACGGGGATGAGAGTGGCTTAGCCTACCACATCACCCTGGTGGAGTTGCTGGCAGCATGCACAGAGGGGTACACTGAAATCAAGTGTAATTCCCTTCTCCCGGACGACATAGTGAGGGTGGTGACCCATGACGACTGCATCCCTGAGGTTAAAATTGCTTATGTGAACTTTGTTAATCACTGTTATGTTGACACTGAAGTGGAAATGAAAGAAATCTATACAAGTAACCACATTTGGAAATTATTTGAGAACTTCTTGGTGGATATGGCAAGGGTTTGCAACACAACTACAGACAGGAAATTTTTGGAAAAGTGTGTTACTGAGTCAATAATGAATATTGTGAGCGGCTTCTTTAATTCTCCCTTTTCAGACAATAGTACCAGCCTCCAGACACATCAGCCAGTTTTTATTCAGCTACTGCAATCTGCCTTCAGAATTTACAATTGCACCTGGCCAAACCCAGCGCAGAAAGCCTCAGTGGAATCCTGTATCAGAACTTTGGCTGAAGTGGCAAAAAATCGTGGAATTGCCATTCCAGTGGATTTGGACAGCCAAGTTAATACTCTTTTCATGAAGAGCCATAATATGGTGCAGAGAGCAGCAATGGGTTGGAGACTATCAGCTCGCTCTGGGCCACGCAAGGAAGCTCTTGGAGGGCCTGATTACAGAAATATTATTGAAAAGTTACAGGATGTAGTGGCCTCCTTGGAGCACCAGTTCAGCCCAATGATGCAGGCTGAATTCTCAGTGTTGGTTGATGTATTGTACAGTCCAGAACTGCTGTTCCCTGAGGGAAGCGATGCAATAAGATGTGGCGCTTTCATGTCGAAGTTGATTAATCATACAAAGAAACTAATGGAGAAAAAACTGTGCATTAAAATTCTTCAGACATTACGAGAAATGTTAGAGAAGAAAGACAGCTTTGTGGAAGGTAACACATTAAGAAAGCTGAATCGATACTTTAAAGGTGATTATAGTATTGGTAATTCCAAAACTGCACAGATATCAATGTCAGACATTCAGTGTCTGCTGGATAAAGAAGGTGCATCAGAACTTGTCATCGTTATAGTGAACACCAAAAATGACAGAATTTTTTCAGAAGGCATTTTCCTCGGCATTGCCTTGCTTGAAGGAGGAAATACACAAACACAGTATTCTTTCTACCAGCAGTTGCATGAACAAAAAAAGTCAGAAAAATTCTTTAAAGTTCTCTATGATCGAATGATAAGATCAACAGTGACAGTTAATGATTTAGGTAACAAAAAAAGGGACGATGACAATGAATTGATGACATCTGGTCCACGAAGAGTAAGAGATTCACTACATTTAAAAGAGGGAATGAAAGGGCAATTAACAGAAGCTTCTTCAGCAACATCCAAAGCATATTGTGTATACAGAAGAGAAATGGATCCAGAAATAAACACTGAGGAATCCGCAGAGGAAGTAACAATGAGTCCCGCAATTGCCATCATGCAGCCAATACTGAGATTTCTTCAGTTACTGTGTGAGAATCACAACCGGGAATTGCAGACCTGTATCGCTACACATGAGTCTAATGGGATTGATATCATCATTGCTTTGATTCTGAATGACATAAACCCTCTTGGTAAATACCGAATGGACCTGGTGCTCCAGCTAAAGAACAATGCATCTAAACTTTTGCTGGCCATTATGGAAAGCAGACATGACAGTGAGAATGCAGAAAGAATTCTTTTTAACATGAGACCCAGAGAACTGGTGGATGTGATGAAGAATGCCTATAACCAAGGATTGGAATGTGACCATGATGATGAGGGTGATGGTGTTTCTCCAAAAGATGTTGGACACAATATCTATATTCTGGCCCATCAGTTGGCCCGCCACAATAAACTGTTGCAGCAGATGCTCAAACCAGGATCGGATCCAGATGAAGGAGATGAAGCCTTAAAGTATTATGCCAACCACACTGCACAGATTGAGATTGTCCGGCATGATAGGACCATGGAACAAATAGTTTTTCCTGTCCCCAATATATGTGAATACCTCACTCGAGAATCCAAGTGCCGTGTGTTCAATACAACTGAAAGGGATGAACAAGGAAGTAAAGTGAATGACTTTTTCCAGCAAACAGAAGATCTCTACAATGAAATGAAGTGGCAGAAGAAAATCAGGAATAACCCTGCACTGTTCTGGTTCTCGAGGCACATCTCTCTCTGGGGGAGCATTTCCTTCAACCTGGCTGTGTTCATCAATTTAGCTGTTGCTCTCTTCTACCCATTT
a0014 TTAGTGGATGACAGATGTGTGGTGCACCCAGAGGCCGGGGACCTTGCCAACCCTCCCAAGAAGTTCAGAGACTGCCTTTTCAAGGTGTGCCCTATGAACAGATATTCTGCCCAGAAGCAATATTGGAAAGCAAAGCAAGCCAAACAAGGGAACCACACTGAGGCAGCCTTGCTGAAGAAACTACAGCACGCTGCAGAACTGGAACAAAAACAAAATGAATCAGAGAATAAGAAACTGTTGGGAGAAATTGTAAAATACAGTAATGTTATACAACTACTGCATATAAAAAGCAACAAATATCTTACTGTCAACAAGAGATTACCTGCTTTACTGGAGAAGAATGCCATGCGTGTGTCCTTGGATGCTGCAGGAAATGAAGGGTCTTGGTTTTATATTCATCCGTTCTGGAAACTGAGAAGCGAGGGTGACAATATTGTTGTAGGAGATAAAGTTGTTTTGATGCCTGTGAATGCAGGGCAGCCACTACATGCCAGCAACATAGAGCTTCTTGATAACCCAGGGTGTAAAGAGGTGAATGCTGTTAATTGCAACACCAGCTGGAAAATCACTTTATTCATGAAATATAGTTCCTATCGAGAGGATGTATTAAAAGGAGGGGACGTTGTTAGATTATTTCATGCGGAACAAGAGAAGTTTTTGACTTGTGATGAATATGAGAAAAAACAGCACATTTTCCTTCGTACGACCTTGCGCCAATCAGCTACTTCTGCTACTAGTTCTAAAGCACTCTGGGAAATAGAGGTGGTTCATCATGACCCATGCCGTGGGGGTGCAGGACAGTGGAACAGCTTGTTCAGATTTAAGCATCTTGCAACTGGAAACTATTTAGCTGCAGAGAGAGATGTCCCTCCAACTTCAAAGAAAAAACGCCAGGCAGAGAAGATCATGTATACTTTGGTTTCAGTCCCGGGCAATGACATTGCATCCCTTTTTGAACTAGATGCCACAACTCTTCAGAGAGCTGACTGCCTGGTTCCAAGGAACTCATATGTTCGGTTAAGGCATTTATGCACCAACACATGGGTAACCAGTACTAGTATCCCCATAGACACAGATGAAGAGAGGCCTGTTATGTTAAAGATTGGAACCTGCCAAACCAAAGAAGATAAAGAAGCGTTCGCAATCGTGTCTGTTCCACTGTCTGAAGTTCGAGACTTAGACTTTGCTAATGATGCCAATAAAGTACTAGCGACCACAGTTAAAAAGCTAGAAAACGGCACAATAACTCAGAATGAAAGGAGGTTTGTAACCAAATTATTGGAAGATCTCATATTCTTTGTTGCTGATGTGCCTAATAATGGACAAGAAGTTGATGTGGTTATCACTAAGCCAAACCGAGAGCGTCAAAAATTGATGAGGGAACAAAACATACTGGCACAGGTATTTGGAATTCTTAAAGCACCCTTTAAAGAGAAAGGAGAAGGCTCGATGCTGAGACTTGAAGATCTGGGGGATCAAAGATATGCACCCTACAAGTACATGCTACGGCTCTGTTACCGCGTCCTGAGACACTCGCAGCAGGATTACCGGAAAAATCAGGAAGCTAAGAATTTCTGTGTCATGCAGTCCCAGATTGGCTATGATATTTTGGCAGAAGATACTATCACAGCTTTGTTGCACAACAACAGAAAACTACTAGAGAAACATATCACAGCAAAAGAAATAGAAACATTTGTCAGTTTACTCAGGAGAAATCGGGAGCCAAGGTTTTTGGATTATTTGTCAGATCTGTGTGTGTCTAATACCACCGCTATCCCTGTAACTCAAGAACTCATCTGTAAATTTATGTTGAGTCCAGGCAATGCAGACATTCTCATTCAAACTAAGGTGGTCTCACAAGCACCCATGGAGAGCTCCCTTTCGGATGACATTGATGATGAAGAAGTTTGGCTCTATTGGATTGACAGCAACATCAGGCACCTTGCTCAAGAGGCAAAAGAAGACTTAGAAGTTCTTACCTATTACAGGTACCAGCTAAACCTCTTTGCAAGGATGTGCTTGGATCGCCAGTATCTGGCCATAAACCAGATTTCTACACAGCTGTCTGTAGACCTGATCCTGCGGTGTGTGTCGGATGAGAGCCTGCCGTTCGACCTCCGAGCGTCCTTCTGTCGCCTCATGCTCCACATGCACGTTGACCGGGATCCCCAGGAGTCCGTGGTGCCTGTTCGCTATGCCAGGCTCTGGACAGAAATCCCCACAAAGATCACAATTCATGAATATGATTCTATAACAGACTCTTCCAGAAATGATATGAAGAGGAAATTTGCCCTGACAATGGAATTTGTTGAAGAATATTTGAAAGAAGTTGTAAACCAGCCCTTTCCTTTTGGGGATAAAGAAAAAAATAAACTGACATTTGAGGTGGTCCACTTGGCTCGGAATCTTATATACTTTGGATTTTATAGTTTCAGTGAGTTATTAAGGCTAACAAGAACACTTCTGGCTATTTTAGACATTGCCCCCATGTCATACTTTGAAAGATTAAGCAAATTTCAAGATGGAGGAAACAATGTGATGAGAACCATTCATGGGGTGGGAGAGATGATGACCCAGATGGTACTCAGTAGAGGCTTCCCCATGAGCATGCCGGATGTGCCACCCAGCATCCACCCGAGCAAGCCCACCGAGCACGAGGATGTGACTGTGATGGACACCAAGCTGAAGATCATTGAGATTTTGATCCTGAGTGTCAGGATCTCAAGAAAGGAAAAAAATCCAGTTCAACTTGACGATCAGGCATTTCAATTACTGGTGTCTAATCAAGACGTAGATAACTACATCAAGGCAGATCTAGACCAGCTTCGACTGAAGTCTGAGGTGAAAGTGCAGGATGGAACAAAGAAACCTCAGATTGACAGCAACAAGAGCAATAACTACCGGATTGTAAAGGAGATTTTGATCAGGCTAAGTAAACTCTGTGTACAGAATAAAAAGTGTCGGAATCAACGATTACTGAAAAATATGGGGGCGCATTCGGTGGTGTTGGATCTTCTGCAGATACCCTATGAAAAGAATGATGAAAAGATGAATGAAGTAATGAATCTAGCCCATACATTTCTGCAGAATTTCTGTCGAGGAAATCCACAGAATCAACTTCTTCATAAACATCTGAGTTTGTTTTTAACTCCAGGTCTCCTTGAAGCAGAAACCATGATCTTCATGAACAATTACCATCTGTGCAACGAAATTAGCGAGAGAGTTGTACAGCACTTTGTGCACTGCATTGAGACACATGGCCGCCACGTGGAGTACCTGAGGTTTTTGCAAACAATTGTAAAAGCAGATGGTAAATATGTGAAGAAATGCCAGGATATGGTAATGACAGAGTTGATACTGATATTTTACAATGATAGAGCATCATTTCCAATCCTTCTCCATATGATGTGTTCAGAGAGAGACGGGGATGAGAGTGGCTTAGCCTACCACATCACCCTGGTGGAGTTGCTGGCAGCATGCACAGAGGGGTACACTGAAATCAAGTGTAATTCCCTTCTCCCGGACGACATAGTGAGGGTGGTGACCCATGACGACTGCATCCCTGAGGTTAAAATTGCTTATGTGAACTTTGTTAATCACTGTTATGTTGACACTGAAGTGGAAATGAAAGAAATCTATACAAGTAACCACATTTGGAAATTATTTGAGAACTTCTTGGTGGATATGGCAAGGGTTTGCAACACAACTACAGACAGGAAATTTTTGGAAAAGTGTGTTACTGAGTCAATAATGAATATTGTGAGCGGCTTCTTTAATTCTCCCTTTTCAGACAATAGTACCAGCCTCCAGACACATCAGCCAGTTTTTATTCAGCTACTGCAATCTGCCTTCAGAATTTACAATTGCACCTGGCCAAACCCAGCGCAGAAAGCCTCAGTGGAATCCTGTATCAGAACTTTGGCTGAAGTGGCAAAAAATCGTGGAATTGCCATTCCAGTGGATTTGGACAGCCAAGTTAATACTCTTTTCATGAAGAGCCATAATATGGTGCAGAGAGCAGCAATGGGTTGGAGACTATCAGCTCGCTCTGGGCCACGCAAGGAAGCTCTTGGAGGGCCTGATTACAGAAATATTATTGAAAAGTTACAGGATGTAGTGGCCTCCTTGGAGCACCAGTTCAGCCCAATGATGCAGGCTGAATTCTCAGTGTTGGTTGATGTATTGTACAGTCCAGAACTGCTGTTCCCTGAGGGAAGCGATGCAATAAGATGTGGCGCTTTCATGTCGAAGTTGATTAATCATACAAAGAAACTAATGGAGAAAAAACTGTGCATTAAAATTCTTCAGACATTACGAGAAATGTTAGAGAAGAAAGACAGCTTTGTGGAAGGTAACACATTAAGAAAGCTGAATCGATACTTTAAAGGTGATTATAGTATTGGTAATTCCAAAACTGCACAGATATCAATGTCAGACATTCAGTGTCTGCTGGATAAAGAAGGTGCATCAGAACTTGTCATCGTTATAGTGAACACCAAAAATGACAGAATTTTTTCAGAAGGCATTTTCCTCGGCATTGCCTTGCTTGAAGGAGGAAATACACAAACACAGTATTCTTTCTACCAGCAGTTGCATGAACAAAAAAAGTCAGAAAAATTCTTTAAAGTTCTCTATGATCGAATGATAAGATCAACAGTGACAGTTAATGATTTAGGTAACAAAAAAAGGGACGATGACAATGAATTGATGACATCTGGTCCACGAAGAGTAAGAGATTCACTACATTTAAAAGAAGGAATGAAAGGGCAATTAACAGAAGCTTCTTCAGCAACATCCAAAGCATATTGTGTATACAGAAGAGAAATGGATCCAGAAATAAACACTGAGGAATCCGCAGAGGAAGTAACAATGAGTCCCGCAATTGCCATCATGCAGCCAATACTGAGATTTCTTCAGTTACTGTGTGAGAATCACAACCGGGAATTGCAGACCTGTATTGCTACACATGAATCTAATGGGATTGATATCATCATTGCTTTGATTCTGAATGACATAAACCCTCTTGGTAAATACCGAATGGACCTGGTGCTCCAGCTAAAGAACAATGCATCTAAACTTTTGCTGGCCATTATGGAAAGCAGACATGACAGTGAGAATGCAGAAAGAATTCTTTTTAACATGAGACCCAGAGAACTGGTGGATGTGATGAAGAATGCCTATAACCAAGGATTGGAATGTGACCATGATGATGAGGGTGATGGTGTTTCTCCAAAAGATGTTGGACACAATATCTATATTCTGGCCCATCAGTTGGCCCGCCACAATAAACTATTGCAGCAGATGCTCAAACCAGGATCAGATCCAGATGAAGGAGATGAAGCCTTAAAATATTATGCCAAGCACACTGCACAGATTGAGATTGTCCGGCATGATAGGACCATGGAACAAATAGTTTTTCCTGTCCCCAATATATGTGAATACCTCACTCGAGAATCCAAGTGCCGTGTGTTCAATACGACTGAAAGGGATGAACAAGGAAGTAAAGTGAATGACTTTTTCCAGCAAACAGAAGATCTCTACAATGAAATGAAGTGGCAGAAGAAAATCAGGAATAACCCTGCACTGTTCTGGTTCTCGAGGCACATCTCTCTCTGGGGGAGCATTTCCTTCAACCTGGCTGTGTTCATCAATTTAGCTGTTGCTCTCTTCTACCCATTT
(((a0003:0.940287,(a0006:0.225433,((a0008:0.070547,(a0013:0.069575,((a0014:0.003074,a0001:0.01845):4e-06,a0005:0.005609):0.079689):0.000897):0.011044,(a0007:0.048967,a0009:0.066015):0.166874):0.139738)#1:0.1328):0.2447,a0012:0.90415):0.965229,((((a0010:0.146055,a0004:0.095622):0.272589,a0011:0.127978):0.109596,a0002:0.382271):0.498846,a0000:0.498494):1.032012);
15 1464
a0011 CTCTTTAAGAGGAGGAATGTTGCCACTGTGGAGGATGATGGCGAGGAAGATGGAATGGCGGATAGCGGCTATTTGGAGTCCCAGGGTAACGTTACAGGTGGGGTGATCTCTGAAGACATGACTCAAATGATCTTCTCCAGTAGTCCTGAGCAGCAGCTAATAGGCACTCAGCGCTTTAGGAAGCTCCTTTCTAAAGAACCCAACCCACCCATTGATGAAGTCATTGCCACTTCAGGGGTGGTGGAGCGCTTTGTGGAATTCCTGAAAAGGAGAGAGAACTGCACATTGCAGTTTGAAGCTGCGTGGGTGTTGACCAACATTGCATCAGGCACATCCCATCAGACTCGGGTGGTAATCCAGGCTGGTGCTGTGCCCATTTTCATAGAGCTCGGCTCTGATTTTGAAGACGTGCAGGAACAGGCAGTGTGGGCCTTGGGAAACATAGCAGGAGATAGCACAGAATGCCGAGACTTTGTCATAGACTGCAACATTCTGCCTTCCCTGGTGCAATTATTGGCCAAGCAGAATCGTCTAACTATGATGAGAAATGCTGTGTGGGCGCTATCAAACCTGTGCAGAGGAAAGAACCCACCTCCGGACTTTACTAAGGTGTCCCCGTGTCTCAGTGTGCTGTCTTGGCTGCTGTTTGTCAATGACACAGACATCCTGGCTGATGCGTGCTGGGCTCTGTCCTACCTATCAGATGGCCCCAATGACAAAATCCAGGCTGTTATTGACTCGGGAGTTTGTCGCAGGCTGGTGGAGTTACTGATGCATTCGGATTATAAGGTGGTATCCCCTGCACTGCGAGCTGTTGGGAACATAGTCACTGGAGACGATCTGCAGACACAGGTGATTTTGAACTGTTCAGCACTGCAGTCCCTACTTCATCTCCTGAGTAGCCCCAAGGAGTCCATAAAAAAAGAAGCCTGCTGGACGATCTCCAACATCACCGCAGGGAACCGAGCACAAATACAGATGGTGATAGATGCTGGCCTGCTGCCTCCTCTCATCAATATCCTTCAGGTAGCGGAGTTTCGCACAAGGAAGGAGGCAGCCTGGGCAATTACCAATGCCACCTCAGGGGGCTCTGCAGAGCAAATAAGGCACCTTGTGGATCTAGGCTGTATAAAACCTCTGTGTGACCTGCTCACACTTATGGACTCCAAAATAGTTCAGGTGGCTCTAAATGGCCTCGAGAACATCTTGCGACTGGGAGAACTGGAGGCCAAGAGGGGAGGCATCAACCCTTACTGTGCCCTCATTGAAGAAGCCTATGGTCTGGACAAGTTGGAGTTCCTGCAGGGACACGAGAACCAGGAAATCTACCAGAAAGCTTTCGACCTGATCGAGCGCTACTTCAACACCGAAGACGAGGACCCGTCTCTGGCGCCAGCCGTCGACCTGCAGCAGCAGCAGTTCCTCTTCCAGCAGTGCGAGGCCCCGATGGAAGGCTTCCAGCTA
a0012 CTCTTTAAGCGCAGAAATGTCGCCTGCGCTGAGGAAGCGACAGAAGAGGAGGGAATGTCCGATGGCAACTTCCACGAGGCACAGATCAACGCTTCCAGTGGGGTTATTACGGGAGACATGATAGAGATGATTTTCTCCAACAACCCAGAGCAGCAGCTTGCAGCGACGCAGAAGTTCAGAAAACTGCTATCAAAAGAGCCCAACCCTCCCATTGATGAGGTTATAGGGACTCCGGGGGTGGTCGCTAGATTCGTGGAATTCCTGAAGCGGAAAGAGAACTGTACATTACAGTTTGAAGCAGCGTGGGTGCTCACTAACATTGCCTCCGGGAACTCCGTACAGACCCGCATTGTCATCCAGGCAGGAGCGGTGCCCATCTTTATAGAGCTCAGCTCAGAGTTCGAAGACGTTCAGGAGCAGGCAGTCTGGGCTCTAGGGAACATTGCCGGAGACAGCACCGTGTGTCGGGATTATGTGTTGGACTGCAATATTCTGCCTCCGCTTTTACAATTACTGTCCAAGCAGAACCGTCTTACAATGACTCGAAATGCAGTGTGGGCACTGTCTAACCTTTGTAGAGGGAAGAATCCACCCCCTGAATTCGCCAAGGTTTCCCCATGCCTCACTGTCCTGTCCTGGCTTCTCTTTGTCAACGACACTGATGTACTTGCCGATGCCTGCTGGGCGCTGTCCTATCTGTCAGATGGGCCGAACGATAAGATCCAGGCCGTGATCGATGCAGGCGTGTGTAGAAGATTAGTGGAACTACTAATGCACAATGATTACAAAGTGGTGTCTCCTGCCCTGCGGGCTGTTGGCAACATAGTGACTGGGGATGACATCCAGACACAAGTGATTCTAAACTGCTCGGCCCTACAGAGTTTGCTGCATCTGTTGAGTAGCCCCAAGGAATCTATAAAGAAGGAGGCATGTTGGACGATATCAAACATCACAGCCGGGAACAGAGTTCAGATACAGACAGTGATTGAGGCCAACATCTTTCCAGCTCTGATAAACATTCTGCAGACGGCAGAATTCAGGACAAGAAAAGAGGCTGCGTGGGCTATCACAAACGCAACATCCGGGGGCTCCGCAGAACAGATCAGGTACCTGGTTGATTTAGGTTGCATCAAACCTCTTTGTGACCTCCTGACTTGCATGGATTCCAAGATCGTACAGGTGGCCCTGAATGGCTTAGAAAACATACTGAGGCTGGGCGAGCAAGAGGCAAAGCGGAACGGGATAATAAACTATAGTGCGTTCTGTGAAGAAGCATATGGACTGGACAAGATCGAGTTCCTACAGAGCCATGAAAACCAGGAGATCTACCAGAAGGCGTTCGACCTGATCGAGCACTACTTCGGCACCGAGGACGAGGACAGCAGCATTGCCCCCCAGGTGGACCTCAGCCAGCAGCAGTTCATCTTCCAGCAACGAGAAGCTCCCATGGAGGGTTTCCAGCTC
a0003 TTATTTAAACGCCGAAATGTTGCAACAGCTGAAGAAGAAGCGGAGGAGGAAGTGATGTCAGATGGTGGCTTCCATGAGGCTCAAATGAACACTTCTAGTGCTGTTATCACTTCTGATATGATTGAGATGATTTTCTCCAATAGTCCAGAACAGCAGCTTTCAGCCACTCAGAAATTCCGAAAGCTCCTTTCTAAAGAACCAAATCCCCCAATAGACGAAGTCATAAGCACACCAGGCGTGGTGGCAAGATTTGTGGAGTTCCTGAAACGGAAAGAAAACTGTACATTACAGTTTGAAGCGGGCTGGGTGCGGACCAATATTGCCTTCGGGGAACCCTTCAGACTTGAAAGGGATTCCAAGCAGGAAGGTGTCCCAACTTTCATAGAGCTTAGTTCAGAGTTTGAAGATGTACAGGAACAGGCAGTATGGGCTCTTGGCAACATTGCTGGAGACAGCACAATGTGCAGAGACTATGTACTGGACTGTAATATTCTGCCTCCCTTACTGCAATTACTTTCAAAACAGAATCGTATCACTATGACCCGAAATGCTGTATGGGCTCTATCCAATCTCTGCAGAGGGAAAAATCCTCCTCCAGATTTTGCCAAGGTTTCGCCTTGTCTTAGTGTGCTTTCCTGGCTGCTGTTTGTCAACGATACAGATGTATTAGCTGATGCCTGCTGGGCTTTGTCCTATTTGTCTGATGGCCCCAACGATAAAATCCAGGCTGTGATTGATGCAGGAGTCTGCAGAAGACTTGTGGAATTGCTGATGCATAACGACTATAAGGTAGTATCTCCTGCCTTACGAGCTGTTGGGAATATTGTCACAGGAGATGATATCCAGACCCAGGTAATTCTAAATTGTTCTGCCCTGCAGAGTTTACTGCATTTGCTAAGCAGCCCTAAAGAATCTATCAAAAAGGAAGCCTGCTGGACAATATCTAATATAACAGCTGGAAACAGAGCCCAGATCCAGACAGTCATTGATGCTCATATCTTTCCAGCTCTTATAAATATTTTGCAAACAGCTGAGTTTCGAACAAGGAAGGAAGCAGCTTGGGCAATCACAAATGCAACGTCTGGAGGCTCTGCCGAACAGATCAAATATTTAGTAGAATTGGGATGCATCAAACCACTCTGTGATCTCCTTACTGTAATGGACTCAAAGATTGTGCAAGTAGCTCTGAGTGGGCTGGAGAACATCTTGAGGCTTGGAGAGCAGGAATCCAAGCGCGCTGGCATTAATCCTTACTGCGCTCTTATTGAGGAAGCATATGGCCTTGACAAGATTGAGTTCCTCCAGAGCCATGAGAATCAAGAGATTTATCAGAAGGCATTTGATCTGATTGAGCACTACTTTGGAACAGAGGATGAAGATAGTAGCATTGCCCCACAGGTGGATCTCAGCCAGCAACAGTACATTTTCCAGCAGTGTGAGGCTCCCATGGAAGGCTTTCAGCTC
a0014 TTATTCAAGCGGAGAAATGTTGCTACAGCAGAAGAAGAAACAGAAGAAGAAGTTATGTCAGATGGAGGCTTTCATGAGGCTCAGATTAATGCACCAGGTGGTGTCATCACTTCTGACATGATTGAAATGATATTTTCCAAAAGCCCAGAGCAACAGCTTTCAGCAACACAGAAATTCAGGAAGCTGCTTTCAAAAGAACCTAACCCTCCTATTGATGAAGTTATCAGCACACCAGGAGTAGTGGCCAGGTTTGTGGAGTTCCTCAAACGAAAAGAGAATTGTACACTGCAGTTTGAATCAGCTTGGGTACTGACAAATATTGCTTCAGGAAATTCTCTTCAGACCCGGATTGTGATTCAGGCAGGAGCTGTGCCCATCTTCATAGAGCTCAGCTCAGAGTTTGAAGATGTCCAGGAACAGGCAGTCTGGGCTCTTGGCAACATTGCTGGAGATAGTACCATGTGCAGGGACTATGTCTTAGACTGCAATATCCTTCCCCCTCTTTTGCAGTTATTTTCAAAGCAAAACCGCCTGACCATGACCCGGAATGCAGTATGGGCTTTGTCTAATCTCTGTAGAGGGAAAAGTCCACCTCCAGAATTTGCAAAGGTTTCTCCATGTCTGAATGTGCTTTCCTGGTTGCTGTTTGTCAGTGACACTGATGTACTGGCTGATGCCTGCTGGGCCCTCTCATATCTATCAGATGGACCCAATGATAAAATTCAAGCGGTCATCGATGCAGGAGTATGTAGGAGACTTGTGGAACTGCTGATGCATAATGATTATAAAGTGGTTTCTCCTGCTTTGCGAGCTGTGGGAAACATTGTCACAGGGGATGATATTCAGACACAGGTAATTCTGAATTGCTCAGCTCTGCAGAGTTTATTGCATTTGCTGAGTAGCCCAAAGGAATCTATCAAAAAGGAAGCATGTTGGACGATATCTAATATTACAGCTGGAAATAGGGCACAGATCCAGACTGTGATAGATGCCAACATTTTCCCAGCCCTCATTAGTATTTTACAAACTGCTGAATTTCGGACAAGAAAAGAAGCAGCTTGGGCCATCACAAATGCAACTTCTGGAGGATCAGCTGAACAGATCAAGTACCTAGTAGAACTGGGTTGTATCAAGCCGCTCTGTGATCTCCTCACGGTCATGGACTCTAAGATTGTACAGGTTGCCCTAAATGGCTTGGAAAATATCCTGAGGCTTGGAGAACAGGAAGCCAAAAGGACTGGCATTAACCCTTACTGTGCTTTGATTGAAGAAGCTTATGGTCTGGATAAAATTGAGTTCTTACAGAGTCATGAAAACCAGGAGATCTACCAAAAGGCCTTTGATCTTATTGAGCATTACTTCGGGACCGAAGATGAAGACAGCAGCATTGCACCCCAGGTTGACCTTAACCAGCAGCAGTACATCTTCCAGCAGTGTGAGGCTCCTATGGAAGGTTTCCAGCTT
a0009 TTATTCAAGAGAAGAAATGTTGCTACAGCAGAAGAAGAAACAGAAGAAGAAGTTATGTCTGATGGTGGCTTTCATGAGGCCCAGATAAATGCACCAGGGGGTGTCATCACCTCTGACATGACTGATATGATATTCTCGAATAGCCCAGAGCAGCAGCTCTCTGCAACACAGAAGTTTAGGAAACTACTTTCAAAAGAACCTAATCCTCCAATTGATGAAGTCATCAACACACCAGGAGTAGTGGCCAGGTTTGTGGAGTTCCTCAAACGAAAAGAAAATTGTACACTGCAGTTTGAATCAGCTTGGGTCCTGACAAATATTGCTTCAGGAAACTCTCTTCAGACCCGGAATGTGATTCAGGCAGGAGCTGTGCCTATTTTCATCGAGCTTAGCTCAGAGTTTGAAGATGTCCAGGAGCAGGCAGTTTGGGCTCTTGGCAACATTGCTGGAGATAGTACCATGTGCAGGGACTATGTCTTAAACTGCAATATCCTTCCTCCTCTTCTGCAGTTATTTTCAAAGCAAAACCGCTTGACCATGACCCGGAATGCAGTATGGGCTTTATCTAATCTCTGTAGAGGGAAGAGCCCACCTCCAGAATTTGCTAAGGTTTCTCCCTGTCTGAATGTCCTTTCTTGGTTACTGTTTGTCAGTGACACTGATGTACTAGCTGATGCTTGCTGGGCTCTCTCATACCTGTCAGATGGACCCAATGATAAAATCCAAGCAGTCATCGATGCAGGAGTCTGCAGGAGGCTTGTGGAACTTCTGATGCATAATGACTATAAAGTAGTTTCTCCTGCTTTGCGGGCTGTGGGAAACATTGTCACAGGGGATGATATTCAGACACAGGTAATTTTGAATTGCTCAGCTCTTCAAAGTTTATTGCATCTGCTGAGTAGCCCAAAGGAATCTATCAAAAAAGAAGCCTGTTGGACAATCTCTAATATTACAGCTGGAAATAGGGCACAGATCCAGACTGTGATAGATGCTAACATGTTCCCAGCTCTTATTAGTATATTGCAAACAGCAGAGTTCCGGACAAGGAAGGAAGCTGCTTGGGCCATCACAAATGCAACTTCTGGAGGATCAGCTGAGCAGATCAAGTACCTAGTAGAACTGGGTTGTATCAAGCCACTCTGTGATCTCCTCACTGTCATGGATGCAAAAATTGTACAGGTTGCCCTAAATGGCTTAGAAAACATCCTGAGGCTTGGAGAACAAGAAGCCAAACGATCAGGCATTAATCCTTACTGTGCTTTGATTGAGGAAGCATATGGTCTGGATAAAATTGAGTTCTTACAGAGTCATGAAAACCAGGAGATCTATCAAAAGGCTTTTGATCTTATTGAGCATTACTTTGGGACCGAAGATGAGGACAGCAGCATCGCACCCCAGGTTGATCTTAGCCAGCAGCAGTACATCTTCCAGCAGTGTGAAGCTCCTATGGAAGGTTTCCAGCTT
a0002 CTATTTAAAAGAAGAAATGTTGCCACTGTGGAGGATGATGGTGAGGATGATGGAATGGCAGATAGTGGTTATCTGGAATCCCAGGCTAACTTTGGGGGTGGGGTCATTTCTGAGGACATGATTCAGATGATTTTCTCCAGCACTCCAGAGCAGCAGCTAATAGGCACACAACGCTTTAGAAAACTCCTTTCTAAAGAGCCCAATCCACCTATTGATGAGGTCATTGCCACTTCAGGGGTGGTGGAGCGTTTTGTTGAGTTCCTAAAAAGAAGAGAAAATTGCACATTGCAGTTTGAAGCTGCGTGGGTTTTGACCAACATTGCTTCAGGCACATCCCACCAGACTAGGGTCGTAATCCAGGCAGGAGCTGTTCCCATATTCATAGAGCTCGCCTCGGATTTTGAAGATGTGCAAGAACAGGCAGTGTGGGCTTTGGGTAATATAGCAGGTGATAGCACAGAATGCAGAGACTTTGTCATAGACTGCAATATTCTACCATCCCTGATCCAATTATTGGCTAAACAGAATCGTTTAACAATGATGAGGAATGCAGTTTGGGCACTGTCTAACCTGTGCAGAGGCAAAAATCCTCCTCCTGACTTCTCCAAGGTGTCCCCCTGTTTGAACGTGCTTTCTTGGCTGCTGTTTGTCCATGACACAGACATCCTTGCTGATGCATGCTGGGCACTCTCCTACTTATCTGACGGCCCAAATGACAAAATCCAGGCTGTTATTGACTCAGGAGTTTGTCGCAGACTGGTGGAACTGCTGTTGCATTCTGATTACAAGGTGGTTTCCCCTGCTCTGAGGGCCGTTGGAAACATCGTCACTGGAGATGATCTGCAGACACAGGTGATTCTGAACTGCTCAGCCCTTCAGTCACTACTTCACCTGCTCAGCAGCCCCAAGGAATCTATTAAAAAAGAAGCTTGCTGGACAATCTCTAACATCACAGCAGGGAATCGAGCACAGATACAGATGGTAATAGATGCAGGTTTGCTGCCACCTCTCATTCACATCCTTCAGGTGGCGGAGTTTCGCACGAGAAAGGAGGCAGCATGGGCCATTACTAATGCCACTTCTGGAGGTTCTGGAGATCAGATTAGGACTCTTGTGGAACTCGGTTGTATAAAACCTCTGTGTGATTTGCTCACACTAATGGATTCCAAAATAGTTCAAGTGGCTCTAAATGGTCTTGAAAACATCTTGCGACTGGGAGAAATTGAAGCCAAAAGAGGTGGAATCAACCCTTACTGTGCCCTCCTGGAGGAGGCCTACGGCCTCGACAAGCTGGAGTTCCTCCAAGGTCACGAGAACCAGGAAATCTACCAGAAAGCATTTGACCTGATTGAGCGCTACTTCAACAGTGAAGATGAAGACCCGTCTCTGGCCCCGGCCGTGGACCTGCAGCAGCAGCAGTTCCTCTTCCAGCAGTGTGAAGCCCCGATGGAGGGCTTCCAGCTA
a0004 CTTTTCAAGAGGAGGAATGTTGCAACAGTGGAGGATGACAGTGAGGATGATGGGATGGCTGATAGTGGCTACCTGGAGTCCCAGGCAAACCTCATGGGTAACGTGATCACTGAAGATATGACTCAAATGATCTTCTCCAGTTCTCCAGAGCAGCAACTAATAGGAACTCAGCGTTTTAGAAAACTGCTATCTAAGGAGCCCAATCCACCCATTGATGAAGTCATCGCCACTGCTGGAGTGGTCGAGCGCTTTGTTGAGTTCTTAAAGAGGAAAGAAAACTGCACTTTGCAGTTTGAGGCTGCGTGGGTGTTAACTAACATTGCATCAGGCACATCCCATCAGACCCGGGTGGTGATCCAGGCTGGGGCTGTGCCCATTTTCATTGAGCTAAGCTCCGATTTTGAAGACGTTCAGGAACAGGCAGTGTGGGCCTTAGGAAACATTGCAGGAGATAGCACAGAATGCAGAGACTTTGTCATAGACTGCAACATACTTCCTTCCTTGGTGCAGCTGTTGGCCAAACAGAACCGTCTAACAATGATGAGAAATGCAGTGTGGGCGCTTTCAAACCTGTGCAGAGGAAAGAATCCTCCTCCGGATTTCACAAAGGTGTCCCCGTGCCTCAGCGTGCTGTCCTGGCTGCTGTTTGTCAACGACACAGACATTCTGGCCGACGCGTGCTGGGCGTTGTCCTACCTATCAGATGGCCCAAATGATAAAATCCAGGCTGTCATTGATTCTGGAGTCTGTCGCAGGCTGGTGGAGTTGCTGATGCACTCTGATTATAAAGTGGTGTCCCCTGCTCTCCGGGCAGTTGGGAATATTGTCACTGGAGATGATCTACAGACACAGGTCATTTTAAACTGTTCAGCACTGCAGTCTCTACTCCAGCTCCTTAGTAGTCCCAAGGAGTCTATCAAGAAGGAAGCCTGCTGGACAATCTCCAACATCACTGCAGGAAATCGAGCACAGATACAGATGGTAATAGATGCAGGTCTCCTGCCGCCTCTCATCACAATCCTACAAGTTGCAGAGTTTCGCACAAGGAAGGAAGCAGCCTGGGCCATCACCAATGCCACCTCAGGGGGTTCTGCAGAACAGATTAGGCACCTTGTGGACCTTGGCTGTATAAAACCTCTGTGTGACCTGCTCACACTCATGGACTCCAAAATAGTTCAGGTGGCTCTCAATGGCCTGGAAAATATCCTGCGACTGGGAGAACTGGAGGCCAAGAGGGCAGGCATTAACCCTTACTGTGCACTCATTGAAGAAGCCTATGGTTTGGACAAGCTGGAGTTTCTGCAGGGCCACGAGAACCAAGAAATCTTCCAGAAAGCCTTCGACCTTGTTGAGCGTTATTTCAACAGTGAGGACGAGGACCCCTCTCTGGCACCCGCCGTCGATCTGCAGCAGCAGCAGTTCCTCTTCCAGCAGTGCGAGGCTCCGATGGAAGGCTTCCAACTA
a0001 TTATTCAAGCGGAGAAATGTTGCTACAGCAGAAGAAGAAACAGAAGAAGAAGTTATGTCAGATGGAGGCTTTCATGAGGCCCAGATCAATGCACCAGGTGGTGTCATCACTTCTGACATGATTGAAATGATATTTTCCAAAAGCCCAGAGCAACAGCTTTCAGCAACACAGAAATTCAGGAAACTGCTTTCAAAAGAACCTAACCCTCCTATTGATGAAGTTATCAGCACACCAGGAGTAGTGGCAAGGTTTGTGGAGTTCCTCAAACGAAAAGAGAATTGTACACTGCAGTTTGAATCAGCTTGGGTACTGACAAATATTGCTTCAGGAAATTCTCTTCAGACCCGGATTGTGATTCAGGCAGGAGCTGTGCCTATCTTCATAGAGCTCAGCTCAGAGTTTGAAGATGTCCAGGAACAGGCAGTCTGGGCTCTTGGCAACATTGCTGGAGATAGTACCATGTGCAGGGACTATGTCTTAGACTGCAATATCCTTCCCCCTCTTTTGCAGTTATTTTCAAAGCAAAACCGCCTGACCATGACCCGGAATGCAGTATGGGCTTTGTCTAATCTCTGTAGAGGGAAAAGTCCACCTCCAGAATTTGCAAAGGTTTCTCCATGTCTGAATGTGCTTTCCTGGTTGCTGTTTGTCAGTGACACTGATGTACTGGCTGATGCCTGCTGGGCCCTCTCATATCTATCAGATGGACCCAATGATAAAATTCAAGCAGTCATCGATGCGGGAGTATGTAGGAGACTTGTGGAACTGCTGATGCATAATGATTATAAAGTGGTTTCTCCTGCTTTGCGAGCTGTGGGAAACATTGTCACAGGGGATGATATTCAGACACAGGTAATTCTGAATTGCTCAGCTCTGCAGAGTTTATTGCATTTGCTGAGTAGCCCAAAGGAATCTATCAAAAAGGAAGCATGTTGGACGATATCTAATATTACAGCTGGAAATAGGGCACAAATCCAGACTGTGATAGATGCCAACATTTTCCCAGCCCTCATTAGTATTTTACAAACTGCTGAATTTCGGACAAGAAAAGAAGCAGCTTGGGCCATCACAAATGCAACTTCTGGAGGATCAGCTGAACAGATCAAGTACCTAGTAGAACTAGGTTGTATCAAGCCGCTCTGTGATCTCCTCACGGTCATGGACTCTAAGATTGTACAGGTTGCCCTAAATGGCTTGGAAAATATCCTGAGGCTTGGAGAACAGGAAGCCAAAAGGACTGGCATTAACCCTTACTGTGCTTTGATTGAAGAAGCTTATGGTCTGGATAAAATTGAGTTCTTACAGAGTCATGAAAACCAGGAGATCTACCAAAAGGCCTTTGATCTTATTGAGCATTACTTCGGGACCGAAGATGAAGACAGCAGCATTGCACCCCAGGTTGACCTTAACCAGCAGCAGTACATCTTCCAACAGTGTGAGGCTCCTATGGAAGGTTTCCAGCTT
a0010 CTTTTCAAGAGGAGGAATGTTGCAACGGTGGAAGATGATGGCGAGGATGATGGGATGGCTGACAGTGGCTACCTGGAGTCACAGGCAAACCTCATGGGTAACGTGATCACAGAAGATATGACTCAAATGATCTTCTCCAGTTCTCCAGAGCAGCAGCTAATAGGAACTCAGCGCTTTAGAAAACTGCTATCCAAGGAACCCAATCCCCCTATTGATGAGGTGATTGCCACTGCTGGAGTGGTGGAGCGCTTTGTTGAGTTCCTAAAGAGGAAAGAAAACTGCACTTTGCAGTTCGAAGCGGCGTGGGTCCTAACCAACATTGCATCAGGGACGTCCCATCAGACCCGGGTGGTGATCCAGGCTGGGGCGGTACCCATTTTCATTGAGCTGAGCTCTGATTTTGAAGACGTGCAGGAACAGGCGGTGTGGGCTTTGGGAAACATTGCAGGAGATAGCACAGAATGCAGAGACTTTGTCATAGACTGCAACATACTTCCTTCCTTGGTGCAGCTGTTGGCCAAACAGAATCGGCTCACAATGATGAGAAATGCAGTGTGGGCGCTATCCAACCTGTGCAGAGGAAAGAATCCGCCTCCAGATTTCACAAAGGTATCCCCGTGTCTCACCGTGCTGTCTTGGCTGCTGTTTGTCAACGACACAGACATTCAGGCCGATGCGTGCTGGGCGTTATCGTACCTATCAGACGGCCCGAACGACAAAATCCAGGCTGTCATTGACTCTGGAGTCTGTCGCAGGCTGGTGGAGTTGCTGATGCACTCGGACTATAAGGTGGTATCTCCTGCTCTTCGGGCAGTTGGGAACATCGTCACCGGAGATGACCTGCAGACACAGGTCATTCTGAACTGTTCAGCACTGCAGTCCCTCCTTCAGCTCCTTAGTAGCCCCAAGGAGTCTATCAAGAAGGAAGCCTGCTGGACAATCTCCAACATCACTGCAGGAAATCGAGCACAGATACAGATGGTAATAGATGCAGATCTCCTGCAACCTCTCATCACAATCCTACAAGTTGCAGAGTTTCGCACACGGAAGGAAGCAGCCTGGGCCATCACCAATGCCACCTCAGGGGGTTCTGCAGAACAGATTAGGCACCTCGTGGAGCTTGGCTGTATAAAACCTCTGTGTGACCTTCTCACACTCATGGACGCCAAAATAGTTCAGGTGGCTCTCAATGGCTTGGAAAACATCCTGCGACTGGGAGAACTGGAGGCCAAGAGGGCCGGCATTAACCCCTACTGTGCCCTCATCGAAGAAGCCTATGGTTTGGACAAGCTGGAGTTCCTGCAGGGCCACGAGAACCCGGAAATCTACCAGAAAGCCTTCGATCTCATTGAGCGTTATTTCAGCAGTGAAGATGAGGACCCCTCCCTGGCCCCCGCCGTCGACCTGCAGCAGCAGCAGTTCCTCTTCCAGCAGTGCGAGGCTCCGATGGAAGGCTTCCAGCTA
a0007 TTATTCAAGAGAAGAAATGTTGCTACAGCAGAAGAAGAAACAGAAGAAGAAGTTATGTCTGATGGTGGCTTTCATGAGGCCCAGATAAATGCACCAGGGGGAGTCATTACCTCTGACATGACTGAGATGATATTCTCCAATAGCCCAGAACAGCAGCTTTCTGCAACACAGAAATTTAGGAAACTACTTTCAAAAGAACCTAATCCTCCTATTGATGAAGTCATCAACACACCAGGAGTAGTGGCCAGGTTTGTGGAGTTCCTCAAACGAAAAGAAAATTGTACACTGCAGTTTGAATCAGCTTGGGTCCTGACAAATATTGCTTCAGGAAACTCTCTTCAGACCCGGATTGTGATTCAGGCAGGAGCTGTTCCTATCTTCATCGAGCTTAGCTCAGAGTTTGAAGATGTCCAGGAGCAGGCAGTCTGGGCTCTTGGCAACATTGCTGGAGATAGCACCATGTGCAGGGACTACGTCTTAGACTGCAATATCCTTCCCCCTCTGCTGCAGTTATTTTCAAAGCAAAACCGCTTGACCATGACCCGGAATGCAGTGTGGGCTTTATCTAATCTATGTAGAGGGAAGAGTCCACCTCCAGAATTTGCTAAGGTTTCTCCCTGTCTGAATGTCCTTTCTTGGTTGCTGTTTGTCAGTGACACTGATGTACTGGCTGATGCTTGCTGGGCTCTCTCATACCTGTCAGATGGACCCAATGATAAAATCCAAGCAGTCATCGATGCAGGAGTATGCAGGAGACTTGTGGAGCTTCTGATGCACAATGATTATAAAGTGGTTTCTCCTGCTTTGCGGGCTGTGGGAAACATTGTTACAGGGGATGACATTCAGACACAGGTAATTTTGAATTGCTCAGCTCTTCAGAGTTTATTGCATCTGCTGAGTAGCCCAAAGGAATCTATCAAAAAAGAAGCATGTTGGACAATCTCTAATATTACAGCTGGAAATAGGGCACAGATCCAGACTGTGATAGACGCTAACATGTTCCCAGCTCTCATCAGTATATTGCAAACAGCAGAGTTCCGGACGAGAAAGGAAGCTGCTTGGGCCATCACAAATGCAACTTCTGGAGGATCAGCTGAGCAGATCAAGTACCTAGTAGAACTGGGTTGTATCAAGCCACTCTGTGATCTCCTCACTGTCATGGATGCAAAAATTGTACAGGTTGCCCTAAATGGCTTAGAAAACATCCTGAGGCTTGGGGAACAAGAAGCCAAAAGATCAGGAATTAACCCTTACTGTGCTTTGATTGAGGAAGCATATGGTCTGGATAAAATTGAGTTTTTACAGAGTCATGAAAACCAGGAGATCTATCAGAAGGCTTTTGATCTTATTGAGCATTACTTTGGGACGGAGGACGAGGACAGCAGCATCGCACCCCAGGTTGACCTTAGCCAGCAGCAGTACATCTTCCAGCAGTGTGAGGCTCCCATGGAAGGTTTCCAGCTC
a0008 TTATTCAAGCGAAGAAATGTTGCTACAGCAGAGGAAGAAACAGAAGAAGAAGTTATGTCAGATGGAGGCTTCCATGAGGCTCAGATTAATGCACCAGGTGGTGTTATTACTTCCGACATGATCGAAATGATATTTTCCAATAGCCCAGAGCAACAGCTTTCAGCAACACAGAAATTCAGAAAACTGCTTTCAAAAGAACCTAATCCTCCTATTGATGAAGTCATCAGCACACCGGGAGTGGTGGCCAGGTTTGTGGAGTTCCTCAAACGAAAAGAGAACTGTACACTGCAGTTTGAATCAGCTTGGGTATTGACAAATATTGCTTCAGGGAATTCTCTTCAGACCCGGATTGTGATTCAGGCAGGAGCTGTGCCTATCTTCATAGAGCTCAGCTCAGAATTTGAAGATGTCCAGGAGCAGGCAGTCTGGGCTCTTGGCAACATTGCTGGAGATAGTACCATGTGCAGGGACTATGTCTTAGACTGCAATATTCTTCCCCCACTTCTGCAGTTATTTTCAAAGCAAAACCGCCTGACCATGACCCGGAATGCAGTATGGGCTTTGTCTAATCTCTGTAGAGGGAAAAGTCCACCTCCAGAATTTGCAAAGGTTTCCCCCTGTCTGAATGTGCTTTCCTGGTTGTTATTTGTCAGTGACACTGATGTCCTGGCTGATGCCTGCTGGGCCCTCTCATATCTGTCAGATGGCCCTAATGACAAAATTCAAGCCGTCATTGATGCAGGAGTATGTAGGAGACTTGTGGAGCTGTTGATGCATAATGATTATAAAGTGGTTTCTCCTGCTTTGCGGGCTGTGGGAAACATTGTCACAGGAGATGATATTCAGACGCAGGTAATTTTGAATTGCTCAGCTTTGCAGAGTTTATTGCATTTGCTGAGTAGCCCAAAGGAATCTATCAAAAAGGAAGCATGTTGGACAATATCTAATATCACAGCTGGAAATAGAGCACAGATCCAGACTGTGATAGATGCCAACATTTTCCCAGCCCTCATTAGTATATTACAAACTGCCGAGTTTCGGACAAGGAAAGAAGCAGCTTGGGCCATCACAAATGCAACTTCTGGAGGGTCAGCTGAACAGATCAAGTACCTCGTAGAACTCGGTTGTATCAAGCCACTTTGTGATCTCCTCACAGTCATGGACTCTAAGATTGTACAGGTTGCCCTAAATGGCTTGGAAAATATCCTGAGGCTTGGAGAACAAGAAGCCAAAAGGACTGGCATTAACCCTTACTGCGCTTTGATTGAAGAAGCATATGGTCTGGATAAAATTGAGTTCTTACAGAGTCATGAAAACCAGGAGATCTACCAGAAGGCCTTTGATCTTATCGAGCATTACTTCGGGACCGAGGATGAGGACAGCAGCATTGCACCCCAGGTTGACCTTAGCCAGCAGCAGTACATCTTCCAGCAGTGTGAGGCTCCTATGGAAGGTTTCCAGCTT
a0013 TTATTCAAGAGAAGAAATGTTGCTACAGCAGAAGAAGAAACAGAAGAAGAAGTTATGTCAGATGGAGGCTTTCATGAGGCTCAGATTAATGCACCAGGTGGTGTTATTACTTCTGACATGATTGAAATGATATTTTCCAATAGCCCAGAGCAACAGCTTTCAGCAACACAGAAATTCAGAAAACTGCTTTCAAAAGAACCTAATCCTCCTATTGATGAAGTCATCAGCACACCAGGAGTAGTGGCCAGGTTTGTGGAGTTCCTCAAACGAAAAGAGAATTGTACACTGCAGTTTGAATCAGCTTGGGTACTGACAAATATTGCTTCAGGAAATTCTCTTCAGACCCGGATTGTGATTCAGGCAGGAGCTGTGCCTATCTTCATAGAGCTCAGCTCAGAGTTTGAAGATGTCCAGGAACAGGCCGTCTGGGCTCTTGGCAACATTGCTGGAGATAGTACCATGTGCAGGGACTATGTCTTAGACTGCAATATTCTTCCCCCTCTTCTGCAGTTATTTTCAAAGCAGAACCGCCTGACTATGACCCGGAATGCAGTATGGGCTTTGTCTAATCTCTGTAGAGGGAAAAGTCCACCTCCAGAATTTGCAAAGGTTTCCCCTTGTCTGAATGTGCTTTCTTGGTTGCTATTTGTCAGTGACACTGATGTACTGGCTGATGCCTGCTGGGCCCTCTCATATCTATCAGATGGACCCAATGATAAAATTCAAGCAGTCATTGATGCAGGAGTATGTAGGAGACTTGTGGAGCTGTTGATGCATAATGATTATAAAGTGGTTTCTCCTGCCTTGCGGGCTGTTGGAAACATTGTCACAGGAGATGATGTTCAGACACAGGTAATTTTGAATTGCTCAGCTCTGCAGAGTTTGTTGCATTTGCTGAGTAGCCCAAAGGAGTCTATCAAAAAGGAGGCGTGTTGGACAATATCTAATATCACAGCTGGAAATAGAGCACAGATCCAGACTGTGATAGATGCCAACATTTTCCCTGCCCTCATTAGTATATTACAAACGGCTGAGTTTCGGACAAGGAAAGAAGCTGCTTGGGCCATCACAAATGCAACTTCTGGAGGATCAGCTGAACAGATCAAGTACCTTGTAGAACTGGGCTGTATCAAGCCACTCTGTGATCTCCTCACAGTCATGGACTCTAAGATCGTACAGGTTGCCCTGAATGGCTTGGAAAATATCCTGAGGCTTGGAGAACAAGAAGCCAAAAGGACTGGCATTAATCCTTACTGTGCTTTGATTGAAGAAGCTTATGGCCTGGATAAAATTGAATTCTTACAGAGTCATGAAAACCAAGAGATCTACCAGAAGGCCTTTGATCTTATTGAGCATTACTTTGGGACCGAGGATGAGGACAGCAGCATCGCACCGCAGGTTGACCTCAGCCAGCAGCAGTACATCTTCCAGCAGTGTGAGGCGCCTATGGAAGGTTTCCAGCTT
a0000 CTGTTCAAGCGCAGAAATGTGGCCACAGTGGAGGAGGATGGAGAAGATGATGGGATGTCTGACAGCGGATACCTGGAATCACAGCCATCGTTAAAGGGAAGTGTTATTTCTGAAGACATGATACAGATGATCTTCTCCAGCTCTCCAGAACAACAGCTCATAGGAACACAGCGCTTCAGAAAGCTCTTATCTAAAGAGCCTAATCCCCCTATTGATGAGGTTATTGCCACCCCTGGTGTCGTGGAGCGATTTGTTGAGTTCCTGAAAAGAAGAGAGAACTGCACACTACAGTTTGAAGCAGCGTGGGTTCTGACTAACATCGCCTCAGGAACATCCCACCAGACGCGTGTGGTCATCCAGGCTGGGGCAGTGCCCATTTTCATTGAGCTCAGCTCAGATTTTGAAGATGTACAGGAGCAAGCAGTGTGGGCTTTAGGTAATATCGCCGGTGACAGCACTGAATGCAGGGACTATGTTCTGGACTGCAATATTTTGCCCTCTCTAGTACAGTTATTGGCCAAACAAAATCGCCTGACTATGATGAGAAACGCAGTCTGGGCTCTGTCTAACCTGTGCAGAGGGAAAAATCCACCACCGGATTTTGCCAAGGTGTCACCGTGTCTCAGTGTTCTGTCCTGGCTGCTGTTTGTGAATGATACTGATATTCTGGCTGATGCATGCTGGGCTCTTTCTTATCTGTCTGATGGTCCCAATGAGAAGATCCAGGCTGTTATTGACTCAGGAGTCTGTCGCAGACTAGTGGAGCTGCTGCTACATGCAGAATATAAGGTGGTGTCTCCTGCTCTAAGAGCCGTGGGGAACATAGTGACAGGAGATGACCTACAGACTCAGGTGATTCTTAACTGCTCTGCCCTGCAAAGTCTTCTTCACTTGCTGAGTAGCCCCAAAGAGTCCATTAAGAAAGAAGCATGTTGGACCATCTCCAATATCACAGCTGGCAATCGTGCACAAATACAGATGGTGATTGACGCAGACTTGTTCCCCCCATTAATAAGTATTCTGCAAGTAGCTGAGTTTCGTACTAGGAAGGAGGCAGCATGGGCAATCACGAATGCCACATCTGGAGGATCCGCAGAACAAATCAGGCATCTTGTTGAGCTTGGGTGCATTAAGCCCTTATGTGACCTCCTGACGCTGATGGACTCAAAGATTGTACAGGTGGCACTAAATGGCTTGGAGAACATCCTGCGACTGGGTGAGCTGGAAGCTAAAAGAGGAGGTATCAACCCCTACTGCGCCCTCATCGAGGAGGCATATGGCTTAGACAAGCTGGAGTTTCTCCAGGGCCACGAGAACCAGGAGATCTACCAGAAGGCTTTCGACCTGATCGAGCGCTACTTCAGCACCGATGATGAAGATCCGTCCCTGGCACCTGCTGTCGACCTCCAGCAGCAGCAGTTCCTCTTCCAGCAGTGCGAGGCTCCCATGGAGGGTTTCCAACTT
a0006 TTGTTTAAGCGAAGAAATGTTGCTACAGCAGAAGAAGAAACGGAAGAAGAAGTAATGTCAGATGGAGGCTTTCATGAGGCCCAGATCAATGCATCAGGTGGTGTCATTACCTCCGATATGATTGAAATGATATTCTCCAATAGCCCAGAGCAACAACTTTCAGCAACTCAGAAGTTCAGAAAGCTACTTTCAAAAGAACCTAATCCTCCAATTGATGAAGTCATCAACACACCGGGAGTGGTGGCCAGGTTTGTGGAGTTCCTCAAACGAAAAGAGAATTGTACATTACAGTTCGAATCAGCTTGGGTGCTGACAAATATTGCTTCAGGGAATTCTCTTCAGACACGAATTGTGATTCAAGCAGGAGCGGTGCCAATCTTCATAGAGCTCAGCTCAGAATTTGAAGATGTGCAGGAACAGGCAGTCTGGGCTCTTGGTAATATTGCAGGAGACAGCACCATGTGTAGAGACTATGTATTAGACTGCAACATTCTCCCCCCGCTCTTGCAGCTTCTTTCAAAGCAGAACCGGTTGACCATGACTCGGAATGCAGTGTGGGCCTTGTCTAATCTCTGCAGAGGGAAAAATCCATCTCCAGATTTTGCAAAGGTTTCCCCCTGTCTGAATGTACTTTCCTGGTTGCTCTTTGTTAATGACACTGATGTGCTAGCTGATGCATGCTGGGCACTATCATATCTATCAGATGGACCCAATGATAAAATCCAAGCAGTAATTGATGCAGGAGTTTGTAGGAGACTAGTGGAGCTACTGATGCATAATGACTACAAGGTGGTTTCTCCTGCTTTACGGGCTGTAGGAAACATTGTTACAGGTGATGATGTTCAGACACAGGTAATTTTGAATTGCTCAGCCCTTCAGAGTTTATTGCATTTACTCAGTAGCCCAAAAGAATCTATCAAAAAAGAAGCTTGTTGGACAATATCTAATATCACAGCTGGAAATAGGGCTCAGATCCAGACTGTGATAGATGCCAACATTTTCCCAGCTCTCATTAACATATTACAAACTGCTGAGTTTCGAACAAGGAAAGAAGCAGCTTGGGCTATTACAAACGCCACTTCTGGGGGTTCAGCTGAACAGATAAAGTACCTAGTGGATCTTGGTTGTATCAAACCACTCTGTGATCTTCTCACAGTCATGGACTCTAAGATTGTTCAAGTTGCCCTGAATGGCTTAGAAAACATCTTGAGGCTTGGAGAGCAAGAGGCCAAGAGGAATGGCATTAACCCTTACTGTGCATTGATTGAGGAAGCATATGGTCTGGATAAAATTGAATTCCTACAGAGTCATGAAAACCAGGAAATCTACCAGAAGGCCTTTGATCTCATTGAGCATTACTTTGGGACAGAGGATGAGGATAGCAGCATCGCTCCTTCAGTTGATCTTGACCAACAGCAGTACATTTTCCAGCAGTGTGAGGCTCCCATGGAAGGTTTCCAACTT
a0005 TTATTCAAGCGGAGAAATGTTGCTACAGCAGAAGAAGAAACAGAAGAAGAAGTTATGTCAGATGGAGGCTTTCATGAGGCTCAGATTAGTGCACCAGGTGGTGTCATCACTTCTGACATGATTGAAATGATATTTTCCAAAAGCCCAGAGCAACAGCTTTCAGCAACACAGAAATTCAGGAAGCTGCTTTCAAAAGAACCTAACCCTCCTATTGATGAAGTTATCAGCACACCAGGAGTAGTGGCCAGGTTTGTGGAGTTCCTCAAACGAAAAGAGAATTGTACACTGCAGTTTGAATCAGCTTGGGTACTGACAAATATTGCTTCAGGAAATTCTCTTCAGACCCGAATTGTGATTCAGGCAGGAGCTGTGCCCATCTTCATAGAGCTCAGCTCAGAGTTTGAAGATGTCCAGGAACAGGCAGTCTGGGCTCTTGGCAACATTGCTGGAGATAGTACCATGTGCAGGGACTATGTCTTAGACTGCAATATCCTTCCCCCTCTTTTGCAGTTATTTTCAAAGCAAAACCGCCTGACCATGACCCGGAATGCAGTATGGGCTTTGTCTAATCTCTGTAGAGGGAAAAGTCCACCTCCAGAATTTGCAAAGGTTTCTCCATGTCTGAATGTGCTTTCCTGGTTGCTGTTTGTCAGTGACACTGATGTACTGGCTGATGCCTGCTGGGCCCTCTCATATCTATCAGATGGACCCAATGATAAAATTCAAGCGGTCATCGATGCGGGAGTATGTAGGAGACTTGTGGAACTGCTGATGCATAATGATTATAAAGTGGTTTCTCCTGCTTTGCGAGCTGTGGGAAACATTGTCACAGGGGATGATATTCAGACACAGGTAATTCTGAATTGCTCAGCTCTGCAGAGTTTATTGCATTTGCTGAGTAGCCCAAAGGAATCTATCAAAAAGGAAGCATGTTGGACGATATCTAATATTACAGCTGGAAATAGGGCACAGATCCAGACTGTGATAGATGCCAACATTTTCCCAGCCCTCATTAGTATTTTACAAACTGCTGAATTTCGGACAAGAAAAGAAGCAGCTTGGGCCATCACAAATGCAACTTCTGGAGGATCAGCTGAACAGATCAAGTACCTAGTAGAACTGGGTTGTATCAAGCCGCTCTGTGATCTCCTCACGGTCATGGACTCTAAGATTGTACAGGTTGCCCTAAATGGCTTGGAAAATATCCTGAGGCTTGGAGAACAGGAAGCCAAAAGGACTGGCATTAACCCTTACTGTGCTTTGATTGAAGAAGCTTATGGTCTGGATAAAATTGAGTTCTTACAGAGTCATGAAAACCAGGAGATCTACCAAAAGGCCTTTGATCTTATTGAGCATTACTTCGGGACCGAAGATGAAGACAGCAGCATTGCACCCCAGGTTGACCTTAACCAGCAGCAGTACATCTTCCAACAGTGTGAGGCTCCTATGGAAGGTTTCCAGCTT
(((((((a0001:0.075468,a0005:0.085411):0.207804,(a0010:0.720769,a0006:0.020905):0.105001):0.012384,(a0000:0.142497,a0012:0.282057):0.018899):0.178792,a0009:0.443433)#1:0.714179,a0008:0.474661):0.143467,a0011:1.098262):0.162709,((a0007:0.348344,(a0003:0.324275,(a0013:0.17518,a0002:0.376901):0.198321):0.112915):0.242393,a0004:0.617143):0.19161);
14 3114
a0010 CCACCACGAAAGGTTCTCATCCTGGGCTCAGGGGGCCTCTCCATTGGCCAAGCTGGAGAGTTTGACTACTCGGGCTCTCAGGCAATTAAGGCCCTGAAGGAGGAAAACATCCAGACATTGCTGATCAACCCCAATATTGCCACAGTGCAGACCTCCCAGGGGCTGGCCGACAAGGTCTATTTTCTTCCTATAACACCTCACTATGTAACCCAGGTGATACGTAATGAACGCCCTGATGGTGTGTTACTGACTTTTGGGGGCCAGACTGCTCTGAACTGTGGTGTAGAGCTGACCAAGGCCGGGGTGCTGGCTCGGTATGGGGTCCGGGTCCTGGGCACACCAGTAGAGACCATTGAGCTGACTGAGGATCGACGGGCCTTTGCTGCCAGAATGGCAGAGATCGGAGAGCATGTGGCCCCCAGCGAGGCAGCAAATTCTCTTGAACAGCTCCAGGATAGGTGCAAGCCACCAGACTACCTCATCCTCCTCCTCTGGCACTTTCTGCTTTGGCCACTAAATGACATTTTTTTTATTATGATGTTTACATCAGAGCAGGGCATTATAGACCTTTTTGGACAGAGTGCCACCAGCCTGATAGATAAGAGCATTTTGTGGTGCTCCAGCTTTCCATTTAGAGCAGTAGTGGCCTTTAAGCATATGTGTATGCATGTGTTAGGTTTCTCTTTTTTAACAAATCTCAAAATAAAAGGTCTTATAACCACAGTTACAAAGAAATCGAACAAATTGTATGATAAAGCACAGATAAATGTCCTTCAGTTAGCAGTTAAATTATGGCAAATCATGGGCAATGTGGGAAAATGTATGATGAAACACAGGATGAATTCCAGATGGTGTTATCATTATGTGAATAAATCAAGCCCAATAACTGGACAGCCATCAGTGGTTTGGGCCACTGTGATAAACTTCCAGTATCCAGTATATGGGGTATATTCCAGTATCCCCATGCCCGTTTTAGGCATATTGATTCTATATTCATTAATAAGCATAAAACCTGAGCTTATCCATGAAAATGGCAGGGAAAAGAGCTATAAGTTAAGATTTCTTTTTTTGTTTGTTTTATTTTGTTTTGTTTTGTTTTGTTTTGGTGAAGTCATGGGCATTGGGCGTTCATTTGAGGAGGCCTTCCAGAAGGCCCTGCGCATGGTGGATGAGAACTGTGTGGGCTTTGATCACACAGTGAAACCAGTCAGCGATGTGGAGTTGGAGACTCCAACAGATAAGCGGATTTTTGTGGTGGCAGCTGCTCTGTGGTCTGGTTATTCGGTGGACCGCCTGTATGAGCTCACACGCATCGACCGCTGGTTCCTGCACCGAATGAAGCGTATCATCACACATGCCCAGCTGCTAGAACAACACCGTGGACAGCCTTTGCCCCCAGACCTGCTGCAACAGGCCAAGTGTCTTGGCTTCTCAGACAAGCAGATTGCCCTTGCAGTTCTGAGCACAGAGCTGGCTGTTCGCAAGCTGCGTCAGGAACTGGGGATCTGTCCGGCAGTGAAACAGATTGACACAGTTGCAGCTGAATGGCCAGCCCAGACAAATTACCTGTACCTAACATACTGGGGCACCACCCACGACCTCACCTTTCGAACACCTCATGTCTTAGTCCTTGGCTCTGGCGTCTACCGTATTGGCTCCAGTGTTGAATTTGACTGGTGTGCTGTAGGCTGCATCCAGCAGCTCCGAAAGATGGGGTATAAGACCATCATGGTGAACTATAACCCAGAGACAGTCAGCACCGACTATGACATGTGTGATCGACTCTACTTTGATGAGATCTCTTTTGAGGTGGTGATGGACATCTATGAGCTCGAGAACCCTGAAGGTGTGATCCTATCCATGGGTGGACAGCTGCCCAACAACATGGCCATGGCGTTGCATCGGCAGCAGTGCCGGGTGCTGGGTACCTCCCCTGAAGCCATCGACTCAGCTGAGAACCGTTTCAAGTTTTCCCGGCTCCTTGACACCATTGGTATCAGCCAGCCTCAGTGGAGGGAGCTCAGTGACCTCGAGTCTGCTCGCCAGTTCTGCCAGACCGTGGGGTACCCCTGTGTGGTGCGCCCCTCCTATGTGCTGAGTGGTGCTGCTATGAATGTGGCCTACACGGATGGGGACCTGGAGCGCTTTCTGAGCAGCGCAGCAGCCGTCTCCAAAGAGCATCCTGTGGTCATCTCCAAGTTCATCCAGGAGGCTAAGGAGATTGACGTGGATGCTGTGGCCTCTGATGGTGTGGTGGCAGCCATCGCCATCTCTGAGCATGTGGAGAATGCAGGTGTGCATTCAGGTGATGCCACGCTGGTGACCCCCCCACAAGATATCACTGCCAAAACCCTGGAGCGGATCAAAGCCATTGTGCATGCTGTGGGCCAGGAGCTACAGGTCACAGGACCCTTCAATCTGCAGCTCATTGCCAAGGATGACCAGCTGAAAGTTATTGAATGCAACGTACGGGTCTCTCGCTCATTCCCCTTCGTTTCCAAGACACTGGGCGTGGACCTAGTAGCGTTGGCCACGCGGGTCATCATGGGGGAAGAAGTGGAACCTGTGGGGCTAATGACTGGTTCTGGAGTCGTGGGAGTAAAGGTGCCTCAGTTCTCCTTCTCCCGCTTGGCGGGTGCTGACGTGGTGTTGGGTGTGGAAATGACCAGTACTGGCGAGGTAGCCGGCTTTGGGGAGAGCCGCTGCGAGGCATACCTCAAGGCCATGCTAAGCACTGGCTTTAAGATCCCCAAGAAGAATATCCTGCTGACCATTGGCAGCTATAAGAACAAAAGTGAGCTACTCCCAACTGTGCGACTACTGGAGAGCCTGGGCTACAGCCTCTATGCCAGTCTCGGCACAGCTGACTTCTACACTGGAGTCAAGGTAACAGCTGTGGACTGGCACTTTGAGGAGGGTTGCCCACCACAGCGGAGCATCCTGGAGCAGCTAGCTGAGAAAAACTTTGAGCTGGTGATTAACCTGTCCATGCGTGGAGCTGGGGGCCGGCGTCTGTCTTCCTTTGTCACCAAGGGCTACCGCACCCGGCGCTTGGCCGCTGACTTCTCTGTGCCCCTAATCATCGATATCAAGTGCACCAAACTCTTCGTGGAG
a0006 CCACCACGAAAGGTTCTGATCCTGGGCTCAGGGGGCCTCTCCATTGGCCAAGCTGGAGAATTTGACTACTCGGGCTCTCAGGCAATTAAGGCCCTGAAGGAGGAAAACATCCAGACGTTGCTGATCAACCCCAATATTGCCACAGTGCAGACCTCCCAGGGGCTGGCCGACAAGGTCTATTTTCTTCCCATAACACCTCATTATGTAACCCAGGTGATACGTAATGAACGCCCCGATGGTGTGTTACTGACTTTTGGGGGCCAGACTGCTCTGAACTGTGGTGTGGAGCTGACCAAGGCCGGGGTGCTGGCTCGGTATGGGGTCCGGGTCCTGGGCACACCAGTGGAGACCATTGAGCTGACCGAGGATCGACGGGCCTTTGCTGCCAGAATGGCAGAGATCGGAGAGCATGTGGCCCCGAGCGAGGCAGCAAATTCTCTTGAACAGGCCCAGGCAGCCGCTGAACGGCTGGGGTACCCTGTGCTAGTGCGTGCAGCCTTTGCCCTGGGTGGCCTGGGCTCTGGCTTTGCCTCTAACAGGGAGGAGCTCTCTGCTCTCGTGGCCCCAGCTTTTGCCCATACCAGCCAAGTGCTAGTAGACAAGTCTCTGAAGGGATGGAAGGAGATTGAGTACGAGGTGGTGAGAGACGCCTATGGCAACTGTGTCACGGTGTGTAACATGGAGAACTTGGACCCACTGGGCATCCACACTGGTGAGTCCATAGTGGTGGCCCCTAGCCAGACACTGAATGACAGGGAGTATCAGCTCCTGAGGCAGACAGCTATCAAGGTGACCCAGCACCTGGGAATTGTTGGGGAGTGCAATGTGCAGTATGCCTTGAACCCTGAGTCTGAGCAGTATTACATCATTGAAGTGAATGCCAGGCTCTCTCGCAGCTCTGCCCTGGCCAGTAAGGCCACAGGTTATCCATATGTGGCAGCCAAGCTAGCATTGGGCATCCCTTTGCCTGAGCTCAGGAACTCTGTGACAGGGGGTACAGCAGCCTTTGAACCCAGCGTGGATTATTGTGTGGTGAAGATTCCTCGATGGGACCTTAAGTTCCTGCGAGTCAGCACAAAGATTGGGAGCTGCATGAAGAGCGTTGGTGAAGTCATGGGCATTGGGCGTTCATTTGAGGAGGCCTTCCAGAAGGCCCTGCGCATGGTGGATGAGAACTGTGTGGGCTTTGATCACACAGTGAAACCAGTCAGCGATATGGAGTTGGAGACTCCAACAGATAAGCGGATTTTTGTGGTGGCAGCTGCTTTGTGGGCTGGTTATTCAGTGGACCGCCTGTATGAGCTCACACGCATCGACCGCTGGTTCCTGCACCGAATGAAGCGTATCATCGCACATGCCCAGCTGCTAGAACAACACCGTGGACAGCCTTTGCCGCCAGACCTGCTGCAACAGGCCAAGTGTCTTGGCTTCTCAGACAAACAGATTGCCCTTGCAGTTCTGAGCACAGAGCTGGCTGTTCGCAAGCTGCGTCAGGAACTGGGGATCTGTCCAGCAGTGAAACAGATTGACACAGTTGCAGCTGAGTGGCCAGCCCAGACAAATTACCTATACCTAACGTATTGGGGCACCACCCATGACCTCACCTTTCGAACACCTCATGTCCTAGTCCTTGGCTCTGGCGTCTACCGTATTGGCTCTAGCGTTGAATTTGACTGGTGTGCTGTAGGCTGCATCCAGCAGCTCCGAAAGATGGGATATAAGACCATCATGGTGAACTATAACCCAGAGACAGTCAGCACCGACTATGACATGTGTGATCGACTCTACTTTGATGAGATCTCTTTTGAGGTGGTGATGGACATCTATGAGCTCGAGAACCCTGAAGGTGTGATCCTATCCATGGGTGGACAGCTGCCCAACAACATGGCCATGGCGTTGCATCGGCAGCAGTGCCGGGTGCTGGGCACCTCCCCTGAAGCCATTGACTCGGCTGAGAACCGTTTCAAGTTTTCCCGGCTCCTTGACACCATTGGTATCAGCCAGCCTCAGTGGAGGGAGCTCAGTGACCTCGAGTCTGCTCGCCAATTCTGCCAGACCGTGGGGTACCCCTGTGTGGTGCGCCCCTCCTATGTGCTGAGCGGTGCTGCTATGAATGTGGCCTACACGGATGGAGACCTGGAGCGCTTCCTGAGCAGCGCAGCAGCCGTCTCCAAAGAGCATCCCGTGGTCATCTCCAAGTTCATCCAGGAGGCTAAGGAGATTGACGTGGATGCCGTGGCCTCTGATGGTGTGGTGGCAGCCATCGCCATCTCTGAGCATGTGGAGAATGCAGGTGTGCATTCAGGTGATGCGACGCTGGTGACCCCCCCACAAGATATCACTGCCAAAACCCTGGAGCGGATCAAAGCCATTGTGCATGCTGTGGGCCAGGAGCTACAGGTCACAGGACCCTTCAATCTGCAGCTCATTGCCAAGGATGACCAGCTGAAAGTTATTGAATGCAACGTACGTGTCTCTCGCTCCTTCCCCTTCGTTTCCAAGACACTGGGTGTGGACCTAGTAGCCTTGGCCACGCGGGTCATCATGGGGGAAGAAGTGGAACCTGTGGGGCTAATGACTGGTTCTGGAGTCGTGGGAGTAAAGGTGCCTCAGTTCTCCTTCTCCCGCTTGGCGGGTGCTGACGTGGTGTTGGGTGTGGAAATGACCAGTACTGGGGAGGTGGCCGGCTTTGGGGAGAGCCGCTGTGAGGCATACCTCAAGGCCATGCTAAGCACTGGCTTTAAGATCCCCAAGAAGAATATCCTGCTGACCATTGGCAGCTATAAGAACAAAAGCGAGCTGCTCCCAACTGTGCGGCTACTGGAGAGCCTGGGCTACAGCCTCTATGCCAGTCTCGGCACAGCTGACTTCTACACTGGCGTCAAGGTAACAGCTGTGGACTGGCACTTTGAGGAGGGTTGCCCACCACAGCGGAGCATCCTGGAGCAGCTAGCTGAGAAAAACTTTGAGCTGGTGATTAACCTGTCAATGCGTGGAGCTGGGGGCCGGCGTCTCTCTTCCTTTGTCACCAAGGGCTACCGCACCCGACGCTTGGCCGCTGACTTCTCCGTGCCCCTAATCATCGATATCAAGTGCACCAAACTCTTTGTGGAG
a0004 CGACCACGTAAAGTTCTGGTTCTGGGTTCAGGTGGTCTTTCCATTGGACAGGCTGGAGAGTTTGACTATTCTGGATCTCAGGCTATAAAAGCTATGAAAGAAGAGAATATCCAAACCATTCTCATCAACCCAAACATTGCCACAGTACAAACCTCAAAGGGCCTGGCAGACAAAGTCTACTTCCTTCCGATCACACCAGAGTACGTCACACAGGTGATAAAGAACGAGCGTCCAGATGGGGTGTTGCTCACTTTCGGAGGTCAGACAGCCCTGAACTGTGGTGTGGAACTCAAAAAACAAGGAGTGCTGGAAAAATACAAAGTGCGTGTGCTTGGTACCCCAGTGGCCTCCATAGAGATGACAGAAGACAGGAAGATCTTTGTGGAGAAGATGGAGGAAATCAACGAGCATGTCGCCCCCAGTGAGGCGGCCATGTCTGTTGAACAGGCAGTGGCTGCAGCTGAAAGACTTGGTTATCCGGTTCTGGTCCGTTCTGCGTTTGCCTTGGGTGGACTGGGTTCAGGCTTTGCCAATAACAGAGATGAGATGATCACGTTGGTCACTCAGGCCTTTGCCCACACATCACAAGTCCTGGTTGACAAATCGCTTAAAGGCTGGAAGGAAATTGAGTATGAAGTAGTGCGGGATGCCTATGACAATTGTGTTACGGTGTGTAACATGGAGAACATCGATCCTCTAGGAATTCACACTGGAGAGTCCATAGTGGTAGCTCCTAGTCAGACACTAAACGACTATGAATACAACATGCTGAGAAACACAGCCATCAAAGTTATTCGCCACTTGGGTGTTGTGGGAGAGTGCAACATTCAGTATGCCCTGAATCCTGAATCAGAGCAGTACTACATCATTGAAGTCAATGCCCGTCTCTCTCGAAGCTCTGCATTGGCCAGTAAGGCCACAGGTTACCCGTACGTGGCTGCTAAACTCAGCTTGGGAATCCCTCTGCCCGTGCTCAAAAATTCAGTGACTAATTCCACAACCGCCTTTGAGCCCAGTCTGGATTACTGCGTGGTGAAGGTTCCTCGCTGGGATTTAAAGTTCCTCAGAGTCAGCACTAAAATAGGCAGCTCCATGAAGAGTGTTGGAGAAGTGATGGCCATCGGCCGCAGCTTTGAAGAGGCCTTCCAGAAAGCTTTGAGAATGGTAGATGAGAACTGCGTTGGATTCGATCACACCATCAAGCCAGAGTCGGAAGAGGAGTTGCAGACTCCCACAGACAAGCGCATCTTTGTTCTGGCAGCTGCTCTGCATGCTGGATATACAGTAGAGCGGCTCTATGAGCTGACCAAGATAGACCACTGGTTTCTGCATAAGATGAAGAACATCGCAGACCACAAGAAGCTTCTGGAGACGTATAAGCAGGATGCAATGCCTCCAGAAATCATGAGGAAAGCCAAGCAACTGGGCTTCTCTGACAAACAGATCGCTCAAGCTGTGCAAAGCACTGAACTGGCTGTGAGGAAGTTGAGACGGGACTGGAAGATCTTTCCAGTGGTCAAACAGATCGACACTGTGGCTGCAGAGTGGCCCGCTCAAACCAACTACCTGTACCTGACATATCACGGCTCAGAAAGTGACGTAGTGTTCGAGCAACCACATGTCATGGTGATTGGCTCCGGGGTTTACCGCATTGGCAGCAGTGTGGAGTTTGACTGGTGTGCTGTTGGGTGTATTATGGAACTCAGAAAGATGGGATATAAAACCATTATGGTGAACTACAACCCGGAAACAGTCAGCACTGATTATGATATGTGTGATAGACTGTATTTTGATGAGATCTCCTTTGAGGTGGTGATGGATATCTATGAGATGGAGAATCCAGAGGGTGTTATTCTGTCTATGGGTGGGCAGCTGCCCAATAACATCGCCATGTCCCTTCACAGACAGCAGTGCAGGATCCTGGGCACCTCACCTGAGTTCATAGACAATGCGGAAAACCGCTTCAAATTCTCCAGAATGCTGGACACCATCGGGATCAGCCAGCCTCGGTGGAAAGAGCTCTCTGATACTGAGTCTGCTGTGAATTTCTGTGAGACGGTGGGTTATCCCTGCTTGGTGAGGCCATCATATGTTCTGAGCGGAGCTGCGATGAACGTGGCCTACTCAGACACGGATATGGAGAAGTTTCTGAGCAGTGCTGTTGCTGTGTCGAAGGAACACCCTGTCGTTATTTCCAAATTCATTCAGGAGGCCAAGGAGATTGATGTGGACGCCGTGGCCTGTGATGGAGAGGTTATTGCCATCGCGGTTTCTGAGCATGTGGAGAACGCAGGGGTTCATTCTGGAGACGCCACACTGGTGACTCCTCCACAGGACATTAACCAGAAAACCATGGAGCGCATTAAGATGATCGTTCATGCTATTGGGCAGGAGCTTCAGGTCACTGGCCCGTTCAACCTGCAGCTCATTGCCAAGGATGATCAGCTGAAGGTGATCGAGTGCAATGTGCGAGTCTCGCGCTCCTTCCCTTATGTGTCCAAAACACTTGGTGTGGATCTTGTCGCGCTTGCAACAAGAGTCATCTTGGGAGAGGAAGTGGAAGCTGTTGGGCTGATGAGGGGGAATGGCATTGTTGGAGTTAAGGTTCCTCAGTTCTCCTTCTCCCGCCTGGCTGGAGCAGATGTGGTTTTGGGTGTTGAGATGACCAGCACTGGAGAAGTGGCCTGCTTCGGGGAGAACCGATATGAGGCCTATCTCAAAGCCATGCTTAGCACCGGCTTCAAGATCCCTAAAAAGAACATTCTGCTCTCTATTGGTAGTTACAAGAATAAGAGTGAGCTGCTGCCCACAGTACAGACTTTGGAGAGTTTGGGTTATAACTTGTATGCAAGTCTTGGCACTGCTGACTTCTACACTGGAGTCAAGGTAATGGCAGTGGACTGGCCATTTGAAGAGAGTTGTCCAAAACAGCGCAACATCATGGACTATCTGGAGGAGAACCATTTTGACTTGGTCATCAATCTGTCTATGAGGAACTCTGGAGGAAGACGCTTGTCCTCTTTTGTGACCAAAGGATACCGAACTCGTCGAATGGCTATTGACTTCTCAGTGCCACTCATAACTGACATAAAGTGCACTAAGCTCTTTGTTCAA
a0008 CGACCCCGCAAGGTGCTGATCCTGGGCTCCGGCGGACTCTCCATCGGGCAGGCGGGCGAGTTTGATTACTCAGGGTCACAGGCCATCAAAGCGCTGAAAGAAGAAAACATTCAGACGGTGCTCATCAACCCCAACATCGCCACAGTGCAGACCTCCAAGGGGCTGGCAGACAAGGTGTACTTCCTGCCCATCACCCCTGAGTATGTCACCCAGGTAATCCGCAACGAGCGCCCCGACGGCGTGCTGCTGACCTTCGGTGGGCAGACAGCCCTCAACTGCGGCGTGGAGCTGACCAAGGGCGGCGTGCTGCAGCGATACCGCGTGCGTGTGCTGGGCACCCCCGTCGCTTCCATCGAGATGACAGAGGACCGCAAGGTCTTCGTGGAGAAGATGGAGGAGATCGGCGAGCACGTGGCACCCAGCAAGGCCGCTGCTTCCCTGGAGCAGGCGCAGGCGGCGGCTGAGCGGTTGGGGTACCCGGTGCTGGTGCGCTCGGCGTACGCCCTGGGGGGCCTGGGCTCCGGCTTTGCCTCCAACCGGGAGGAGCTGGCGGCCCTGGTGAGCCAGGCCTTCACCCACACCTCCCAGGTGCTGGTGGACAAGTCGCTGAAGGGCTGGAAGGAGATTGAGTACGAGGTGGTGCGCGACGCCTACAACAACTGCGTCACGGTGTGCAACATGGAGAACCTGGACCCGTTGGGCATCCACACGGGCGAGTCCATCGTGGTGGCACCCAGCCAGACGCTCAATGACACCGAGTACTTCATGCTGCGCCACACGGCCATCAAGGTGGTGCAGCACCTGGGCATTGTTGGCGAGTGCAACATCCAGTTCGCCCTGAACCCCGAGTCGGAGCAGTACTACATCATCGAGGTGAACGCGCGGCTCTCCCGCAGCTCGGCACTGGCCAGCAAAGCCACAGGTTACCCGTACGTGGCAGCCAAGCTGGCACTGGGCATCCCGCTGCCTGTCCTCAGAAACTCCGTCACCAACTCCACCACCGCCTTCGAGCCCAGCCTGGACTACTGCGTGGTGAAGATCCCGCGCTGGGACCTCAAGTTCCTGCGTGTCAGCACCAAGATCGGCAGCTCCATGAAGAGCGTGGGGGAGGTGATGGCCATCGGCAGGAACTTCGAGGAGGCCTTCCAGAAGGCGCTGCGGATGGTGGATGAGAACTGCGTGGGCTTTGACCACACGGTCAGGCCCTCTGCCCCCCAGGAGCTGGAGACACCGACAGACAAGCGCATCTTCGTGCTGGCGGCGGCGCTGCGTGCTGGCTATTCCATTGAGCGCCTCTACGAGCTGACCAAGATCGACCGCTGGTTCCTGCACAAGATGAAGAACATCACGGACCACGCGGCGCGGCTGGAGGCGTTCCGCGGAGAGGCCATGCCGCCCGCCGTGCTGCGCCGTGCCAAGCAGCTCGGCTTCTCCGACAAGCAGGTGGCCCTGGCCGTGCTCAGCACCGAGCTGGCCGTGCGGAAGATGCGGCGCGACCTGGGCATCCTGCCGGTGGTGAAGCAGATCGACACGGTGGCGGCCGAGTGGCCGGCGCAGACCAACTACCTCTACCTGACCTACAATGGTGCCGAGCATGACCTGCCCTTCCGCCAGCCCCACGTCATGGTCATCGGTTCTGGTGTTTACCGCATCGGCAGCTCCGTCGAGTTCGACTGGTGCGCTGTCGGCTGCATCCAGGAGCTGCGCAAGATGGGCTTCAAGACCATCATGGTGAATTACAACCCTGAGACTGTGAGCACTGACTATGACATGTGTGACCGCCTCTACTTTGATGAGATCTCCTTTGAGGGGGNGANGGACATCNACGAGCNGGAGAACCCTGCTGGAGTCATCCTGTCAATGGGCGGCCAGCTGCCCAACAACATCGCCATGGCGCTGCACCGGCAGCAGTGCCGCATCCTGGGCACCTCCCCCGAGGCCATCGACTCAGCTGAGAACCGCTTCAAGTTCTCTCGCCTGCTGGACACCATCGGCATCAGCCAGCCACTCTGGAAGGAGCTCTCCGACATGGAGTCAGCCAAGCACTTCTGCTGCACGGTGGGCTACCCCTGCGTGGTGCGGCCCTCCTACGTGCTGAGTGGTGCTGCCATGAACGTCGCCTACTCGGACAGTGACCTGGAGAAGTTTCTCAGCAACGCCGTGGCCGTGTCCAAGGAGCAGCCCGTTGTCATCTCCAAGTTCATCCAGGAGGCCAAGGAGATCGACGTGGATGCGGTCGCCTGTGACGGCGTGGTGGTGGCCATTGCCATCTCTGAGCACGTGGAGAACGCTGGAGTGCACTCGGGCGATGCCACGCTGGTGACCCCCCCGCAGGACATCACGCCCAAGACTCTGGAGCGCATCAAGGCCATCGTGCACGCCATTGGGCAGGAGCTGCAGGTCACCGGGCCCTTCAACCTGCAGCTTATCGCCAAGGATGACCAGCTGAAGGTGATCGAGTGCAACGTGCGCGTGTCGCGCTCCTTCCCTTTCGTCTCCAAGACGTTGGGGGTGGACCTGGTGGCCTTGGCCAGCCAGGTGATCATGGGTGAGGATGTGCAGCCCGTAGGGCTGATGACGGGCACGGGCATTGTCGGTGTCAAGGTGCCGCAGTTCTCCTTCTCACGGCTGGCGGGTGCTGACGTTGTGCTGGGTGTGGAGAAGACGAGCACGGGTGAGGTGGCCTGCTTTGGGGAGAACCGCTTTGGGGCGTACCTCAAGGCCATGCTCAGCACCGGCTTCAAGATCCCCAAGAAGAACATCCTACTGACCATCGGCAGCTACAAGAACAAGAGCGAGCTGCTGCCCACCGTGCGGACCCTGGAGAGCCTTGGCTACAATCTGTATGCCAGCCTTGGCACTGCTGACTTCTACACCGGCATCAAGGTGATGGCAGTGGATTGGCACTTTGAGGAGACTGCGGGTACGCAGCGCAGCATCCTGGACTACTTGGCAGAGAACCACTTTGAGATGGTCATCAACCTCTCCATGCGCAACTCTGGGGGCCGCCGGCTTTCCTCCTTTGTCACCAAGGGGTACCGCACGCGGCGCCTGGCCGTCGACTACTCCGTGCCTCTCATCATTGACATCAAGTGCACCAAGCTCTTCGTGGAG
a0012 GCACCACGAAAGGTTCTGATTCTGGGCTCAGGGGGCCTCTCCATCGGCCAGGCCGGCGAGTTTGACTACTCAGGCTCTCAGGCGATCAAGGCCCTGAAGGAGGAAAACATTCAGACATTGCTGATCAACCCTAACATCGCTACCGTGCAGACTTCACAGGGGCTGGCGGACAAGGTCTATTTCCTCCCCATAACACCTCACTACGTAACCCAGGTGATACGTAATGAGCGCCCAGATGGTGTGTTACTGACTTTTGGGGGCCAAACAGCTCTGAACTGTGGTGTGGAGCTGACCAAGGCTGGGGTGCTTGCTCGGTACGGAGTCCGGGTCCTGGGCACACCCGTGGAGACCATTGAGTTGACTGAAGATCGGCGTGCCTTCGCCTCCAGGATGGCAGAGATCGGAGAGCATGTGGCCCCCAGCGAGGCAGCGAATTCTCTTGAGCAGGCCCAGGCAGCTGCTGAGAGACTGGGATACCCTGTGCTGGTGCGCGCAGCCTACGCCTTGGGTGGCCTGGGCTCTGGCTTTGCCTCTAACAAAGAGGAGTTGTCTGCTCTCGTGGCCCCAGCTTTTGCCCATACCAGCCAAGTGCTGGTAGATAAGTCCCTGAAAGGATGGAAGGAGATTGAGTATGAGGTGGTGAGAGATGCCTATGGCAACTGTGTCACGGTGTGTAACATGGAGAACCTAGACCCGCTGGGCATCCACACCGGGGAGTCCATCGTGGTGGCTCCAAGCCAGACGCTAAATGACAGGGAGTACCAGCTGCTGAGGCAGACGGCCATCAAGGTGACTCAGCACCTCGGAATCGTCGGGGAGTGCAACGTGCAGTATGCCCTGAACCCTGAGTCTGAGCAGTACTACATCATTGAAGTGAATGCCAGGCTCTCTCGCAGCTCTGCCCTAGCCAGTAAGGCCACAGGCTACCCATATGTGGCAGCCAAGCTGGCTTTGGGCATCCCTCTGCCTGAACTCAGGAACTCTGTGACAGGGGGAACGGCAGCCTTTGAACCCAGTCTGGATTACTGTGTGGTGAAGATTCCTCGCTGGGACCTCAAGTTCCTCCGCGTCAGCACAAAGATTGGGAGCTGCATGAAGAGCGTGGGTGAAGTCATGGGCATTGGGCGTTCTTTTGAGGAGGCCTTCCAGAAGGCTCTGCGCATGGTGGATGAGAACTGCGTGGGCTTTGATCACACGGTCAAGCCCGTCAGTGATATGGAGTTAGAGACTCCAACAGACAAGCGCATCTTCGTGGTGGCAGCAGCCCTATGGGCTGGCTACTCAGTGGATCGCCTGTATGAACTCACTCGCATCGACCGCTGGTTCCTGCACCGGATGAAGCGGATCATAGCACACACCCAGCTGCTAGAGCAACACCGTGGACAACCTTTGCCCCCAGACCTGCTTCATCAGGCCAAGCGCCTTGGCTTCTCAGACAAGCAGATTGCCCTCGCGGTCCTCAGCACAGAGCTGGCTGTTCGCAAGCTGCGTCAGGAACTAGGGATCTGCCCAGCAGTGAAGCAGATTGACACGGTTGCAGCTGAGTGGCCGGCCCAGACAAATTACTTGTACCTGACATACTGGGGCACCACCCATGACCTCACCTTTCGAACACCCCATGTCCTAGTCCTTGGCTCTGGCGTCTACCGTATCGGCTCCAGCGTCGAGTTTGACTGGTGTGCCGTGGGCTGTATCCAGCAGCTGCGAAAGATGGGGTATAAGACCATCATGGTGAACTACAACCCAGAGACAGTCAGCACCGACTACGACATGTGTGACCGACTCTACTTCGATGAAATCTCTTTTGAGGTGGTGATGGACATCTATGAGCTGGAAAACCCTGAAGGTGTGATCTTGTCCATGGGTGGGCAGCTGCCCAACAACATGGCCATGGCTTTGCATCGGCAACAGTGTCGGGTTCTGGGCACCTCCCCAGAAGCCATTGACTCAGCTGAGAACCGTTTTAAGTTCTCCCGGCTCCTGGACACCATTGGTATCAGCCAGCCTCAGTGGAGGGAGCTCAGTGACCTAGAGTCTGCTCGCCAGTTCTGCCAGACCGTGGGGTACCCCTGTGTCGTGCGCCCCTCCTATGTGCTGAGTGGTGCTGCTATGAACGTGGCCTACACCGATGGGGACTTGGAGCGCTTCTTGAGCAGTGCAGCAGCTGTCTCCAAGGAGCACCCCGTGGTCATCTCCAAGTTCATCCAGGAGGCCAAGGAGATTGACGTGGATGCTGTGGCTTGTGATGGTGTGGTGGCAGCTATCGCCATCTCCGAACACGTAGAGAATGCAGGTGTGCATTCAGGTGATGCCACACTGGTGACCCCACCGCAGGACATCACTGCCAAAACCCTGGAGCGGATCAAAGCCATTGTGCATGCCGTGGGCCAGGAGCTGCAGGTCACAGGACCCTTCAATCTGCAGCTCATTGCCAAGGACGACCAGCTGAAAGTCATTGAATGCAACGTGCGTGTGTCTCGCTCCTTCCCCTTCGTCTCCAAGACACTAGGTGTGGACCTAGTAGCCTTGGCGACACGGGTCATCATGAGGGAAGAAGTGGAGCCTGTGGGACTCATGACTGGCTCTGGAGTTGTGGGGGTGAAGGTGCCCCAGTTCTCGTTCTCCCGCCTGGCGGGGGCTGACGTGGTGCTGGGTGTGGAGATGACCAGTACTGGGGAAGTAGCTGGCTTTGGGGAGAGCCGCTGCGAAGCCTACCTCAAGGCCATGCTCAGTACTGGTTTTAAGATCCCCAAGAAGAACATCTTGCTGACCATTGGCAGCTATAAGGTAAGAACCGATTCTCTCCCTGTTTCCCTGCTATCCATGTCATTGTATGAATCATCTGTTCCACGCTCAGGTTGCTCCAGTCTTGTCTCTGGGCCACAGGTGACGGCTGTGGACTGGCATTTTGAAGAGGGATCCCCACCACAGCGAAGCATTTTGGAGCAGCTTGCTGAGAAAAACTTTGAACTCGTAATTAACCTGTCCATGCGTGGGGCCGGGGGCCGGCGTCTTTCTTCCTTCGTCACCAAGGGCTACCGGACACGGCGCCTGGCCGCTGACTTCTCCGTACCCCTCATCATTGATATCAAGTGCACCAAACTGTTTGTGGAG
a0011 CGCCCACACAAAGTGCTGATCCTGGGCTCAGGGGGGCTGTCGATTGGCCAGGCCGGGGAGTTCGACTACTCTGGCTCCCAGGCCATCAAAGCTCTGAAGGAAGAGAACATCCAGACTGTCCTGATTAACCCCAACATCGCCACAGTGCAGACATCGAAAGGCCTCGCCGACAAGGTTTATTTCCTGCCAATCACCCCTGAATATGTCACTCAGGTACTCTCTCTCCAGCAAGGAGGCTCCTGTCTGTACAGTATGGGGGTACAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGTAGGAGGTGCCATAGTGTTTCCCTTAGACAGTACAACAGTACAGTATGGGGGTACAGCTTATGTGCCCAGAACATTCCCTCTCTGTATATTTGTATTTATACATATGGTAATGCTCTTGTGCCTCCAGGCCCAGGCTGCTGCAGAACGTCTCGGGTATCCGGTTTTGGTCCGGTCGGCCTACGCGCTGGGCGGCCTTGGATCTGGATTTGCCAGTACCAAGGAGGAGTTGACTGCCCTGGTGTGCCAGGCCTTCGCCCACACCACACAGGTCCTGGTGGATAAATCCCTGAAGGGCTGGAAGGAGATAGAGTACGAAGTCGTGCGGGACGCCTATAATAACTGTGTCACGGTGTGCAACATGGAGAACGTAGATCCCCTGGGCATTCACACTGGCGAGTCCATCGTGGTAGCTCCCAGCCAGACGCTGAACGATCGAGAGTACAACATGCTGCGCAACACGGCCATTAAGGTTATCCAGCACCTCGGCATTGTGGGCGAGTGTAACATACAGTACGCCCTAAACCCGGAGTCTGAGCAGTATTACATCATCGAGGTGAACGCACGGCTGTCTCGCAGCTCAGCCCTGGCGAGTAAAGCAACTGGTTACCCCTATGTGGCTGCCAAGCTGGCACTGGGAATTCCTCTGCCCGTTCTCAGAAACTCCGTGACCAACTCCACCACAGCCTTTGAGCCCAGCCTGGATTACTGTGTGGTGAAGGTTCCGCGCTGGGACCTGAAGTTCTTGCGAGTCAGCACCAAGATTGGCAGCTCCATGAAGAGTGTGGGGGAGGTCATGTCTGTTGGTAGGAACTTTGAAGAAGCCTTCCAGAAAGCTCTGCGCATGGTGGACGAGAACTGCGTGGGCTTTGATCACTGCATCAAATCCGCATCTGATGAGGAACTGGAGACGCCGACAGACAAGAGGATCTTCGTTCTGGCCGCTGCCCTGCGTGCAGGTTACACTATCGAGCGCCTTTATGAGTTGACCAAGATTGACAGGTGGTTCCTCCATAAGATGAAGAATATTACTGATCAGGTGGCCACGCTGGAGTCCTACCACCAGGATTTGATGCCCCGTGAGGTCCTTCTCCGAGCCAAACAGCTGGGCTTCTCCGACAAGCAGATTGCCCTGGCCGTGCAGAGCACGGAGCTGGCAGTCCGCAAGATGCGGCAGGAGCTGCTGATTTTGCCGGTAGTAAAGCAGCTTGACACGGTGGCGGCGGAGTGGCCGGCTCAGACCAATTACCTGTATCTGACCTATAATGGAACTGAGCACGACTTGGCCTTTGAGGAGCCGCATGTTATGGTGATTGGCTCTGGTGTTTACCGAATAGGCAGCAGTGTGGAGTTTGATTGGTGCGCGGTGGGCTGCATCCAGGAACTGCGTAAGATGGGATTTAAGACCATCATGGTGAATTATAACCCCGAGACTGTCAGCACAGACTATGACATGTGTGACCGCCTGTATTTTGACGAGATCTCATTTGAGGTGGTGATGGATATCTATGAGCTGGAGAACCCAGAGGGAATCATACTGTCCATGGGTGGCCAGCTGCCCAATAATATTGCCATGTCCCTACATCGCCAGCAGTGCCGGGTGCTGGGCACTTCTCCTGAGGCCATCGACTCCGCTGAGAACAGGTTTAAGTTTTCTCGCATGTTGGACACGATCGGAATCAGTCAGCCGCAGTGGAAAGAGCTGTCTGACATGGAGTCGGCCGTTCAGTTCTGTAACACCGTCGGTTTCCCCTGCGTGGTGCGCCCATCCTACGTGCTAAGTGGAGCCGCCATGAATGTGGCCCATTCAGATGGAGACCTGGAGAAGGTGCTCAGTAACGCTGTGGCTGTGTCCAAGGAGCATCCCGTGGTCATCTCTAAATTCATCCAGGAGGCCAAGGAAATTGATGTGGATGCTGTGGCATGTGATGGAGTTGTTGTGGCCGTGGCTATTTCAGAACATGTGGAGAATGCTGGGGTTCACTCTGGGGATGCCACACTGGTGACCCCTGCTCAGGATATCACCCCCAAAACCTTGGAAAGGATTAAAGCCATTGTCCATGCTGTGGGGCTGGAGCTCCAAGTCAACGGACCCTTTAACCTGCAGCTCATTGCAAAGGACGACCAGCTGAAAGTGATCGAGTGCAATGTCCGTGTGTCGCGCTCCTTTCCCTTTGTATCGAAGACTCTGGGAGTCAATCTAGTCGCTCTGGCAACGCAAGTCATTATGGGAGAAGAGGTTGAACCTGTTGGTGTGATGACTGGTACTGGCATTGTAGGGGTTAAGGTCCCACAGTTCTCGTTCTCACGCTTGGCCGGCGCGGACGTGGTCCTTGGGGTGGAGATGACCAGCACCGGGGAGGTTGCCTGCTTTGGAGAGAACCGATACGAGGCCTATCTAAAAGCCATGCTAAGTACCGGCTTCAAAATTCCACAGAAGAACATCCTACTGACCATCGGGAGCTACAAGAACAAGAGTGAGCTGCTGCCCACGGTGCGAGCCATGGAGAGTCTTGGCTACAGTCTGTATGCCAGCCTGGGAACTGCTGACTTCTATACGGGCATCAAGGTAAAGGCAATGGATTGGCCCTTTGAGGAGAATGGGCCCAAGCAGGGCAGCATCATGGACCATCTGTCAGAGAATCACTTTGATTTGGTCATTAATTTGTCCATGCGGAATTCTGGGGGGCGCCGACTCTCCTCCTTCGTTACCCGTGGGTACCGTGCCCGCCGCTTGGCTGTGGACTATTCTGTGCCCCTCATCATTGATATCAAGTGCACCAAACTCTTTGTGGAG
a0002 CGACCCAAAAAGGTGCTAATCCTGGGCTCAGGAGGACTGTCGATTGGCCAGGCTGGAGAATTTGACTACTCGGGCTCCCAGGCTATCAAAGCTCTCAAGGAGGAGAACATCCAGACGGTGCTGATCAACCCCAACATCGCCACCGTGCAGACTTCCAAGGGTCTGGCTGACAAAGTCTACTTTCTGCCCATCACACCGGACTACGTCGCCCAGGTGTTAAAGAACGAGCGGCCTGACGGCATCCTGCTGACCTTCGGCGGTCAGACGGCTCTGAACTGCGGTGTGGAGCTCACCAAGCAGGGGGTCCTGGAGAAGTACAAAGTCAAGGTTCTGGGAACGCCGGTGGCCTCCATCGAGATGACGGAAGACAGGAAAATCTTTGTGGAGAAAATGGAGGAGATCAACGAGCACGTGGCTCCCAGTGAAGCGGCGCTGTCTGTGGAGCAGGCTGTGGCCGCTGCGGAGCGTCTGGGCTACCCTGTTCTGGTTCGCTCAGCGTTCGCTCTGGGAGGTCTGGGTTCGGGCTTCGCCAACAACAGGGAGGAGCTCGTCTCCTTGGTGACCTCGGCCTTCGCACACACCTCACAGGTGCTGGTGGACAAATCACTGAAGGGCTGGAAGGAGATCGAGTACGAGGTGGTCCGGGACGCCTATGACAACTGCGTCACTGTGTGTAACATGGAGAACATCGACCCTCTGGGAATCCATACGGGAGAGTCCATCGTGGTGGCGCCGAGCCAAACGCTCAACGACCACGAGTACAACATGCTGAGGAGCACGGCCATCAAAGTCATCCGACACCTGGGCATCGTTGGGGAGTGTAACATCCAGTACGCTCTGAACCCAGAGTCCCATCAGTACTACATCATCGAGGTGAACGCTCGCCTCTCCCGTAGTTCGGCCCTGGCGAGCAAGGCCACGGGCTACCCTTATGTGGCAGCTAAACTTGGCCTGGGCATCCCGCTGCCACAGCTGAAGAACTCTGTGACCAACTCGACCACGGCCTTTGAGCCCAGCCTGGACTACTGCGTGGTCAAGGTGCCCCGGTGGGATCTCAAGTTCCTGAGGGTCTCCACCAAGATCGGCAGCTCCATGAAGAGCGTCGGCGAGGTGATGGCTATCGGCCGAAGCTTTGAGGAGGCCTTCCAGAAAGCTCTGAGGATGGTGGATGAGAACTGCGTCGGCTTTGATCACACCATCAAACCTGTGTCTGAAAAGGTATTGAATAAACCAACAAACGTAAGAGAGTTCCGTTTAGCGGCGCATCTTCGTCCTGGCCGCGGCCTTGATGAAGAACATCACAGACCACGAGCGGCTGCTGGAGACTTACAATGCGCCCGGCACTTGCGGCGCTCTTCTGTAACCTTGGGTCTGACTTGCCAGGACGCCATGCCTCCGGAGGTGATGCTGAAAGCCAAGCAGCTCGGCTTCTCGGACAAGCAGATCGCTCTGGCTGTGCAGAGCACCGAGCTTGTGGTGAGGAAGCTGCGCCACGATCGGTCCATCCTGCCTGTGGTAAAGCAGATCGACACAGTGGCCGCCGAGTGGCCCGCCTTCACCAACTACCTGTACCTGACCTACCACGGCACCGAGAACGACCTGCATTTCAACGACCAGCACGTCATGGTGATCGGCTCCGGCGTTTACCGCATCGGCAGCAGCGTGGAGTTTGACTGGTGCGCCGTCGGATGCATCACTGAGCTCAGGAAGATGGGCTACAAGACCATCATGGTGAACTACAACCCGGAGACGGTCAGCACGGACTATGACATGTGTGACCGCCTCTACTTTGATGAGATCTCCTTCGAGGTGGTGATGGACATCTACGAGAGGGAGAACCCAGACGGGATCATCCTCTCCATGGGAGGTCAGCTGCCCAACAACATCGCCATGTCTCTGCACCGCCAGCAGTGCCGCATCTTGGGAACCTCGCCGGAGTTCATAGACAGCGCTGAGAACAGGTTCAAGTTCTCCCGCATGCTGGACACCATCGGGATCAGCCAGCCGCAGTGGAAGGAGCTCTCCGACACCGACTCGGCCGTCAAGTTTTGCCAAACGGTTGGGTACCCCTGCCTGGTCCGGCCCTCCTACGTTCTCAGTGGCGCCGCCATGAACGTTGCCTACAGCAACAGTGACCTTGAGAAGTACCTGAGCAGCGCTGTAGCTGTGTCCAAAGAACACCCGGTGGTCATCTCCAAATTCATCCAGGAGGCCAAGGAGATCGATGTGGACGCGGTGGCCTGTGACGGGGTGGTGATGGCCATCGCCATATCGGAGCACGTGGAGAACGCTGGCGTTCACTCTGGAGACGCTACTTTGGTGACACCACCTCAGGACCTCAACCAGAAGACGATGGAGACCATCAAGATGATCGTGCATGCCATCGGCCAGGAGCTGCAGGTCACAGGACCGTTTAACCTGCAGCTGATTGCAAAGGACGACCAACTGAAGGTGATCGAGTGCAACGTGCGCGTCTCCCGCTCCTTCCCCTTCGTGTCCAAGACCCTGGGTGTGGACCTGGTGGCCATGGCCACTCAGGCCATCATGGGGGAGGATGTGGAGCCTCTGGGCCTGATGGCAGGAAAGGGGATCGTCGGGGTCAAGGTTCCTCAGTTCTCCTTCTCCAGGTTGGCTGGTGCTGACGTGGTGTTGGGCGTAGAGATGACCAGCACTGGGGAGGTGGCCTGCTTTGGGGAGAACCGATATGAGGCCTATCTGAAAGCCATGCTGTCTACAGGCTTCAAGATCCCCAAAAAGAACATCCTGCTCTCCATTGGCAGCTACAAGAACAAAAGTGAGCTGCTGCCCACCGTCCAGGCTCTGGAGTCCCTGGGTTACGATCTGTACGCCAGTCTGGGAACCGCCGATTTCTACACAGGAGTCAAAGTGACGGCGGTCGATTGGCCGTTCGAGGAGGGCTGTCCGAAGCAGCGCAGCATCATGAACTACCTGGAGGAGAACCACTTTGACCTGGTCGTCAACCTGTCCATGAGGAACAGCGGAGGGCGCAGGCTCTCCTCCTTCGTCACCAAGGGTTACCGGACCAGGCGCATGGCGGTGGACTACTCCGTCCCGCTCATCATCGACATCAAATGCACCAAGCTCTTCGTTCAG
a0009 TCTCCCCGAAAAGTGCTGATCCTGGGCTCAGGGGGTCTCTCCATTGGCCAGGCTGGAGAGTTTGACTACTCTGGCTCTCAGGCAATCAAGGCCCTAAAGGAGGAAAATATTCAAACGCTGCTGATAAATCCTAATATTGCCACAGTGCAAACCTCCCAGGGACTGGCGGACAAAGTCTATTTCTTGCCTATAACTCCTCATTATGTGACTCAGGTTATTCGTAATGAGCGTCCAGATGGTGTATTACTGACATTTGGGGGCCAGACAGCACTGAATTGTGGTGTGGAGCTGACTAAGGCTGGGGTTCTGGCCCGGTATGGAGTACGGGTCCTAGGCACCCCCGTAGAGACAATTGAGCTGACTGAGGATCGGCGTGCTTTTGCAGCAAGGATGGCAGAAATTGGAGAACATGTGGCCCCGAGCGAGGCTGCAAACTCCCTGGAACAGGCGCAAGCTGCTGCAGAACGACTGGGGTACCCGGTCCTGGTACGTGCTGCCTTTGCCCTAGGTGGCCTTGGCTCCGGCTTTGCTTCTAGCAGAGAAGAACTCTCCTCTCTGGTGGCCCCAGCCTTTGCTCACACTAGTCAAGTACTGGTGGACAAGTCCCTCAAGGGATGGAAAGAAATAGAATATGAAGTGGTGAGAGATGCCTATGGCAACTGTGTCACGGTATGTAACATGGAAAATCTAGATCCACTGGGCATTCACACTGGTGAATCTATAGTTGTGGCCCCAAGCCAGACACTAAACGACAGGGAATATCAGCTGTTGCGACAGACTGCTATCAAGGTGACTCAACACCTGGGCATTGTTGGGGAGTGCAATGTACAATATGCCTTGAACCCTGAGTCTGAACAGTACTATATCATTGAAGTGAATGCACGACTGTCTCGGAGTTCGGCCCTTGCCAGTAAAGCCACTGGTTATCCTTATGTAGCAGCCAAGCTGGCTTTGGGTATCTCCTTGCCTGATCTCAGGAACTCGGTAACTGGGGGTACTGCTGCTTTTGAGCCCAGCCTGGATTACTGCGTGGTTAAGGTCCCTCGCTGGGACCTTAAGTTCCTCCGAGTTAGCACAAGGATTGGAAGCTGCATGAAGAGTGTTGGTGAGGTCATGGCTATTGGACGTGGGTTCGAAGAGGCATTCCAAAAGGCCTTGCGCATGGTGGATGAGAACTGTGTTGGCTTTGATCACACAATGAAGCCCGTCAGTGACATGGAGCTGGAAACGCCAACAGACAAGCGGATCTTTGTGGTAGCAGCTGCTTTGTGGGCAGGATATACCATAGACCGACTGTATGAGCTTACTCGCATTGATCGCTGGTTCCTGCAGTGCATGAAACGCATTATAGAGCACACTCGAAAACTAGAGGAACACCGTGGGCAGCCCTTGCCCCCTGATTTGCTGCACCAGGCCAAGCGCCTTGGATTCTCCGACAAGCAGATTGCCCTCGCAGTACTCAGCACAGAGCTGGCCGTACGAAAACTACGGCAGGAGCTGGGCATCTGTCCAGCGGTCAAGCAGATTGATACAGTGGCAGCAGAGTGGCCAGCTCAAACCAACTATCTGTACCTGACTTATGGTGGCACCACCCATGACCTGGCTTTCCACGCTCCCCATGTCCTGGTCTTGGGCTCTGGCGTTTACCGCATTGGCTCCAGTGTGGAATTTGACTGGTGTGCTGTGGGCTGCATCCGGCAGCTGCGCAAGATGGGGTATAAGACTATTATGGTGAACTATAACCCTGAGACAGTCAGTACTGATTATGACATGTGTGATCGGCTCTACTTTGATGAGATCTCTTTTGAGGTGGTGATGGATATCTATGAGCTAGAAAACCCTGAGGGTGTAATCCTCTCCATGGGAGGTCAGTTGCCCAACAACATGGCAATGGCCCTGCATAGGCAGCAGTGCCGAGTCCTTGGCACATCCCCAGAAGCCATCGACTCTGCTGAGAACAGATTCAAATTTTCCCGACTTCTTGACACCATTGGCATCAGTCAGCCTCAGTGGCGAGAACTCAGTGACTTGGAGTCTGCTCGCCAGTTCTGTCACACCGTGGGGTACCCTTGTGTTGTCCGCCCATCCTATGTGCTGAGTGGTGCAGCTATGAATGTGGCCTATACTGATGGAGACCTTGAGCGATTTCTGAGCAGTGCAGCTGCTGTCTCCAAAGAACATCCTGTGGTCATCTCCAAGTTCATCCAAGAGGCCAAGGAAATTGACGTGGATGCTGTGGCTTGTGATGGCATGGTGGTTGCTGTAGCTATCTCAGAGCATGTGGAGAATGCAGGGGTGCACTCAGGGGATGCCACTTTGGTGACTCCTCCTCAAGACATCACACCTAAGACATTGGAAAGGATCAAAGCAATTGTTCACGCTGTGGGTCAAGAGCTACAGGTCACAGGGCCTTTCAATCTTCAGCTCATTGCCAAGGATGACCAGCTCAAGGTTATCGAGTGCAATGTCCGTGTCTCTCGGTCCTTCCCCTTTGTCTCTAAGACACTTGGAGTAGATCTGGTAGCCCTGGCTACCCGAATTATCATGGGTGAGGAGGTGGAGCCTGTTGGGCTCATGGCTGGAACTGGAGTAGTGGGAGTTAAGGTGCCCCAGTTCTCATTCTCACGCCTGGCAGGAGCAGATGTGGTGCTGGGTGTAGAGATGACCAGCACTGGGGAAGTGGCTGGCTTTGGGGAGAGCCGCTGTGAGGCCTACCTCAAGGCTATGCTAAGCACTGGCTTCAAGATCCCCAAGAAGAATATCCTGCTGACTATTGGTAGTTACAAGAACAAGAGTGAGCTGCTCCCTACAGTGAGGCTGTTGGAGAGTCTAGGCTATAGCTTATATGCCAGTTTGGGCACAGCAGACTTCTACACAGGTGTCAAGGTTACAGCCGTGGACTGGCACTTTGAGGAGGGTTGTCCTCCACAACGAAGCATCCTGGAACAGTTGGCAGAAAACCACTTTGAACTGGTCATCAACCTGTCAATGCGAGGGGCAGGGGGTCGACGCCTCTCCTCCTTTGTAACCAAGGGGTACCGGACCCGTCGCCTGGCTGCAGACTTCTCTGTGCCACTCATCATTGACATCAAGTGCACTAAGCTATTTGTAGAG
a0005 CCTCCACGAAAGGTTCTAATCCTAGGCTCAGGGGGCCTCTCCATTGGCCAAGCTGGAGAATTTGACTACTCGGGCTCTCAGGCAATTAAAGCCCTAAAGGAGGAAAACATCCAGACATTACTAATCAACCCCAACATTGCCACAGTGCAGACTTCTCAGGGGCTGGCAGACAAGGTCTATTTCCTTCCCATAACACTTCACTACGTAACCCAGGTAATTCGTAATGAACGCCCAGATGGTGTGTTACTGACTTTTGGGGGTCAAACAGCCCTGAACTGCGGTGTGGAGCTGACCAAAGCTGGGGTACTGGCTCGATATGGGGTCCGGGTCTTGGGTACACCCGTGGAGACCATTGAACTGACTGAGGACCGACGAGCCTTCGCTGCCAGGATGGCTGAGATCGGAGAGCATGTCGCCCCCAGTGAAGCGGCAAATTCTCTTGAACAGGCTCAGGCAGCTGCCGAGCGACTAGGCTACCCTGTGCTGGTGCGAGCAGCCTTTGCCCTGGGTGGTCTCGGTTCTGGCTTTGCTTCCACCAAAGAGGAACTCTCAGCTCTTGTGGCTCCAGCTTTTGCCCATACCAGTCAGGTGCTGATAGACAAGTCTCTGAAGGGCTGGAAGGAGATTGAATATGAGGTGGTGAGAGACGCCTATGGCAACTGCGTAACGGTATGCAACATGGAGAACTTAGACCCACTGGGCATTCATACTGGTGAATCCATAGTGGTGGCTCCGAGCCAGACACTGAATGACAGAGAGTACCAGCTTCTGCGACGGACAGCTATCAAGGTCACTCAGCACCTGGGCATTGTCGGGGAGTGCAATGTACAGTATGCTTTGAACCCCGAGTCTGAGCAGTATTACATCATTGAAGTGAATGCCAGGCTCTCCCGAAGCTCTGCCCTGGCCAGTAAGGCCACAGGCTATCCATATGTGGCAGCCAAGCTAGCATTGGGCATTCCCCTGCCAGAGCTCAGAAACTCTGTTACGGGAGGAACAGCAGCCTTTGAGCCCAGCCTGGACTACTGCGTGGTAAAGATTCCTCGCTGGGACCTCAAGTTCCTACGTGTCAGTACGAAGATTGGGAGTTGCATGAAGAGTGTTGGCGAGGTCATGGGCATCGGGCGGTCCTTTGAGGAGGCCTTCCAAAAGGCCCTGCGCATGGTCGATGAGAACTGCGTAGGCTTCGACCATACAGTAAAGCCAGTCAGCGACATGGAGCTGGAGACTCCGACGGATAAGCGGATCTTTGTGGTGGCTGCCGCTCTGTGGGCTGGCTACTCTGTGGAGCGCCTCTACGAGCTCACCCGCATTGATTGCTGGTTCCTGCACCGGATGAAGCGCATTGTGACCCACGCCCAGTTGCTGGAACAACACCGTGGACAAGCTTTACCCCAAGACCTGCTGCACCAGGCCAAGTGCCTCGGCTTCTCAGACAAGCAGATTGCCCTGGCAGTCCTGAGCACAGAGCTGGCTGTTCGGAAGCTGCGTCAGGAACTGGGGATCTGCCCAGCGGTGAAACAGATTGACACAGTTGCAGCTGAGTGGCCAGCCCAGACAAATTACCTGTACCTGACATACTGGGGCAACACCCATGACCTCGACTTTCGGGCACCTCACGTCCTGGTCCTTGGCTCTGGTGTCTACCGGATTGGCTCCAGTGTTGAGTTTGATTGGTGTGCTGTGGGTTGCATCCAGCAGCTCCGGAAGATGGGTTATAAGACCATCATGGTGAACTACAACCCAGAGACAGTCAGCACCGACTATGATATGTGTGACCGACTCTACTTTGATGAGATCTCTTTTGAGGTGGTGATGGACATCTATGAGTTAGAGAACCCCGAAGGTGTGATCCTGTCCATGGGTGGGCAGCTGCCCAACAACATGGCCATGGCTTTGCATCGGCAGCAGTGCCGAGTGCTGGGCACCTCCCCCGAAGCCATCGACTCAGCCGAGAACCGATTCAAGTTCTCCCGGCTCCTAGATACCATCGGTATCAGCCAGCCTCAGTGGCGAGAGCTCAGTGACCTTGAGTCTGCTCGCCAGTTCTGCCACACGGTCGGGTACCCCTGCGTAGTGCGCCCCTCCTATGTGCTCAGCGGTGCTGCTATGAATGTGGCGTACACCGACGGGGACCTGGAGCGTTTCCTGAGCAGTGCGGCCGCCGTCTCTAAGGAGCACCCCGTAGTCATCTCCAAGTTCATTCAGGAAGCAAAGGAGATCGACGTGGACGCGGTGGCCTGTGACGGCATCGTGTCGGCCATTGCCATCTCTGAGCACGTGGAGAATGCAGGTGTGCATTCAGGTGATGCCACGCTGGTGACCCCCCCACAAGACATCACCCCGAAAACTCTGGAGCGGATCAAAGCCATTGTGCATGCTGTGGGCCAGGAGCTACAGGTTACAGGACCCTTCAATCTGCAGCTCATTGCCAAGGATGACCAGCTGAAGGTTATTGAATGCAACGTGCGTGTATCTCGCTCTTTCCCCTTCGTGTCCAAGACACTGGGTGTTGATCTAGTAGCCTTGGCCACAAGGATCATCATGGGGGAGAAAGTAGAGCCCGTGGGGCTCATGACTGGCTCTGGAGTCGTGGGAGTAAAGGTACCTCAGTTCTCCTTCTCACGCTTGGCCGGTGCCGACGTGGTACTTGGTGTGGAGATGACCAGTACTGGAGAGGTGGCCGGCTTCGGAGAGAGCCGTTGTGAAGCCTACCTCAAAGCCATGCTCAGCACTGGCTTTAAGATCCCAGAGAAGAACATCCTGCTGACTATTGGCAGCTACAAGAACAAAAGTGAGCTGCTCCCAACTGTGCGGTTGCTGGAGAGCCTGGGCTACAGCCTCTATGCCAGCCTGGGTACGGCAGACTTCTACACTGGGGTCAAGGTAACAGCTGTGGACTGGCACTTTGAAGAGGGTTGCCCACCACAACGGAGCATCTTGGATCAGCTGGCTGAAAATCACTTTGAGCTAGTGATTAACCTGTCCATGCGTGGGGCTGGGGGTCGGCGTCTTTCCTCCTTCGTTACCAAGGGCTACCGTACCCGGCGTCTGGCCGCTGATTTCTCTGTGCCTCTCATCATTGACATCAAGTGCACCAAACTCTTTGTGGAG
a0001 CCACCACGAAAAGTTCTGATCCTGGGCTCGGGGGGCCTCTCCATTGGCCAGGCTGGAGAATTTGACTACTCGGGCTCTCAGGCAATTAAAGCCCTAAAGGAGGAGAACATCCAAACATTACTGATCAACCCCAACATTGCCACAGTGCAGACTTCTCAGGGGCTGGCAGACAAGGTCTATTTCCTTCCCATAACACCTCACTACGTAACCCAGGTGATTCGTAATGAACGCCCAGATGGTATATTACTGACTTTCGGGGGTCAGACAGCCCTGAACTGCGGTGTGGAGCTGACCAAAGCTGGGGTACTAGCTCGGTATGGGGTCCGGGTCTTGGGTACACCTGTGGAGACCATTGAACTGACTGAGGACCGGCGAGCCTTTGCTGCCAGAATGGCTGAGATTGGAGAGCACGTTGCCCCCAGTGAAGCTGCAAATTCTCTTGAACAGGCTCAGGCAGCTGCCGAGCGGCTAGGCTACCCTGTGCTGGTGCGAGCAGCCTTTGCCCTGGGTGGTCTTGGTTCTGGCTTTGCTTCCACCAAAGAGGAACTCTCAGCTCTTGTGGCTCCAGCCTTTGCCCATACCAGCCAGGTGCTGATAGACAAGTCTCTGAAGGGCTGGAAGGAGATTGAATATGAGGTGGTGAGAGATGCCTATGGCAACTGCGTAACGGTATGTAACATGGAGAACTTAGACCCACTGGGCATCCATACGGGGGAGTCCATAGTGGTGGCTCCAAGCCAGACACTGAATGACAGAGAGTACCAGCTTCTGCGGCGGACAGCTATCAAGGTCACCCAGCACCTGGGGATTGTTGGGGAGTGCAATGTGCAGTATGCCTTGAACCCCGAGTCTGAGCAGTATTACATCATTGAAGTAAATGCCAGGCTCTCCCGAAGCTCTGCCCTGGCCAGTAAGGCCACAGGCTATCCATATGTGGCAGCCAAGCTAGCATTGGGCATTCCCCTGCCAGAGCTCAGAAACTCTGTTACGGGGGGAACAGCAGCCTTTGAGCCCAGCCTGGACTACTGCGTGGTAAAGATTCCTCGCTGGGACCTCAAGTTCCTGCGTGTCAGTACCAAGATTGGGAGCTGCATGAAGAGTGTTGGTGAAGTCATGGGCATCGGGCGTTCCTTTGAGGAGGCCTTCCAAAAGGCCCTGCGCATGGTAGACGAGAACTGTGTAGGCTTCGACCATACAGTGAAGCCAGTCAGCGACGTGGAGCTGGAGACGCCGACGGATAAGCGGATCTTTGTGGTGGCTGCTGCTCTGTGGGCTGGCTACTCTGTGGAGCGCCTCTACGAGCTCACCCGCATCGACTGCTGGTTCCTGCACCGGATGAAGCGCATTGTGACCCACGCCAAGTTGCTGGAACAACACCGTGGACGGCCCTTACCCCAAGACCTGCTGCACCAGGCCAAGTGCCTCGGCTTCTCAGACAAGCAAATTGCTCTTGCAGTCCTGAGCACAGAGCTGGTTGTTCGGAAGCTGCGTCAGGAACTGGGGATCTGCCCAGCAGTGAAGCAGATCGACACAGTTGCAGCTGAGTGGCCAGCCCAGACAAATTACCTGTACCTGACATACTGGGGCAACACCCATGACCTCGACTTTCGGACACCTCACGTCCTGGTCCTTGGCTCTGGCGTCTACCGGATCGGCTCCAGCGTTGAGTTTGATTGGTGTGCTGTGGGCTGCATCCAGCAGCTCCGGAAGATGGGTTATAAGACCATCATGGTGAACTACAACCCAGAGACAGTCAGCACCGACTATGATATGTGTGACCGACTCTACTTTGATGAGATCTCTTTTGAGGTGGTGATGGACATCTATGAGTTAGAAAACCCCGAAGGTGTGATTCTGTCCATGGGCGGGCAGCTGCCCAACAACATGGCTATGGCTTTGCATCGGCAGCAGTGCCGAGTGCTGGGCACCTCCCCCGAAGCCATCGACTCAGCCGAGAACCGGTTCAAGTTCTCCCGGCTCCTAGATACCATTGGTATCAGCCAGCCTCAGTGGCGAGAGCTCAGTGACCTCGAGTCCGCTCGCCAGTTCTGCCAGACCGTTGGGTACCCCTGCGTAGTGCGTCCCTCCTATGTGCTGAGTGGTGCTGCTATGAACGTGGCCTACACTGATGGGGACCTGGAGCGCTTCCTGAGCAGTGCAGCTGCTGTCTCTAAGGAGCACCCTGTGGTCATCTCCAAATTCATTCAGGAGGCAAAGGAGATTGATGTAGATGCTGTGGCCTGTGACGGCATCGTGTCGGCTATTGCCATCTCTGAGCACGTGGAGAATGCAGGTGTGCATTCAGGGGATGCCACGCTGGTGACCCCCCCACAAGACATCACCCCCAAAACTCTGGAGCGGATCAAAGCCATTGTGCATGCTGTGGGCCAGGAGCTACAGGTCACGGGGCCCTTCAATCTGCAGCTCATTGCCAAGGACGACCAGCTGAAGGTCATTGAATGTAACGTGCGGGTGTCGCGCTCCTTCCCGTTCGTGTCCAAGACACTTGGTGTCGACCTCGTAGCCTTGGCCACAAGGATCATCATGGGGGAGAAAGTAGAGTCCGTGGGGCTCATGACTGGCTCTGGAGTCGTGGGAGTAAAGGTACCTCAGTTCTCCTTCTCACGCTTGGCCGGTGCTGACGTGGTCCTGGGTGTGGAGATGACCAGTACTGGAGAGGTGGCTGGCTTCGGAGAGAGCCGTTGTGAAGCCTACCTCAAAGCCATGCTCAGCACTGGCTTTAAGATCCCAAAGAAGAACATCCTGCTGACCATTGGCAGCTACAAGAATAAAAGTGAGCTGCTCCCAACTGTGCGGTTGCTGGAGAGCCTGGGCTACAGTCTGTATGCCAGCTTGGGAACTGCCGACTTCTACACCGGCGTCAAGGTAACAGCTGTGGACTGGCACTTTGAAGAGGGTTGCCCACCACAACGGAGCATCTTGGATCAGCTGGCCGAGAATCACTTTGAGCTGGTGATTAACCTGTCGATGCGCGGGGCTGGGGGTCGGCGTCTTTCCTCCTTCGTTACCAAGGGCTACCGCACCCGGCGTCTGGCCGCGGATTTCTCCGTGCCTCTCATCATTGATATCAAGTGCACCAAACTCTTCGTGGAG
a0007 AGACCCAAGAAAGTTCTCATCCTGGGTTCTGGAGGTCTGTCCATCGGTCAGGCGGGCGAGTTCGACTACTCTGGATCCCAGGCCATTAAAGCCCTGAAGGAGGAGAACATCCAGACGGTGCTGATCAACCCCAACATCGCCACGGTGCAGACCTCCAAGGGTCTGGCCGATAAAGTCTACTTCCTTCCGATCACGGCGGAGTACGTGACTCAGGTGATCAAGAACGAGCGCCCTGATGGCGTCCTGCTCACCTTCGGGGGTCAGACTGCCTTGAACTGTGGCGTGGATCTGACCAAACTGGGCGTGTTGGAGAAATACAATGTCCGGGTTCTGGGGACCCCTGTGGCCTCCATCGAGATGACGGAGGACCGGAAGGTCTTTGTGGAGAAGATGGAGGAGATCAACGAGCACGTGGCTCCCAGCGAAGCCGCTCTGTCCGTGGAGCAGGCCGTGGCGGCTGCCGAGCGTTTGGGTTACCCCGTCCTGGTCCGTTCTGCGTTCGCTCTCGGAGGTCTGGGTTCAGGTTTCGCCAACACCCGAGAGGAGCTGACCTCCCTGGTGACGTCGGCCTTCGCCCACACCTCCCAGGTCCTGGTGGACAAGTCCCTGAAAGGCTGGAAGGAGATCGAGTACGAGGTGGTCCGGGACGCCTACGACAACTGTGTGACCGTGTGCAACATGGAGAACATCGACCCGCTGGGCATCCACACCGGGGAGTCCATCGTGGTCGCTCCCAGCCAGACGCTCAACGACCACGAGTACAACATGCTGAGGAACACGGCCATCAAAGTGATCCGGCACCTCGGCATCGTGGGAGAGTGTAACATCCAGTACGCTCTGAACCCCGAATCGGACCAGTACTACATCATCGAGGTGAACGCCCGTCTGTCCCGTAGCTCCGCCTTGGCCAGTAAAGCCACCGGTTACCCTTACGTGGCGGCTAAACTGGGTCTGGGGATCCCGCTGCCGCAGCTCAAGAACTCTGTCACCAACTCAACGACGGCCTTTGAGCCCAGTCTGGATTACTGCGTGGTGAAGGTTCCTCGCTGGGATCTCAAGTTCCTCCGGGTTTCCACCAAGATAGGGAGCTCCATGAAGAGCGTCGGGGAGGTGATGGCCATCGGCCGCTGCTTTGAGGAGGCCTTCCAGAAAGCTCTGAGGATGGTGGATGAGAACTGCGTGGGCTTTGATCACACCATCAAGCCTGTTTCTGACAACGAGCTGCAGACGCCCACAGACAAACGCATCTTCGTGCTGGCGGCGGCGCTCAAAGCCGGCTACACGGTGGACCAGCTGTACCAGCTCACCAAGATCGACCGCTGGTTCCTGCATAAGATGAAGAACATCTCCGACCACGAGCGACTTCTGGAGACCTACAACCAGGATACCATGCCTCCTGCGGTGATGCTGAAGGCCAAGCAGCTGGGCTTCTCCGACAAGCAGATAGCGCAGGCCGTGCAGAGCACCGAGCTGGCGGTCAGAAAGATGCGCCGGGACTGGTCCATACTGCCCGTGGTCAAGCAGATCGACACGGTGGCGGCAGAGTGGCCCGCCTACACCAACTACCTGTACCTGACCTACCACGGTACGGAAAACGACCTGAGCTTTCAGGAGCCGCACGTCATGGTGATCGGCTCGGGCGTTTACCGCATCGGCAGCAGCGTGGAGTTCGACTGGTGTGCGGTCGGATGCATCACAAAGCTCAGGAAGATGGGTTTTAAGACCATCATGGTCAACTACAACCCAGAGACGGTCAGCACGGACTACGACATGTGTGACCGCCTCTACTTCGACGAGATCTCTTTTGAGGTGGTGATGGACATCTATGAGAGGGAGAACCCAGAAGGGGTCATCTTGTCCATGGGGGGCCAGCTGCCCAACAACATTGCCATGGCTCTTCATCGGCAGCAGTGTCGGATCTTGGGAACGTCGCCGGAGTGCATCGACGGCGCCGAGAACAGGTTCAAGTTCTCCAGGATGCTGGACACCATCGGCATCAGCCAGCCTCAGTGGAAGGAGCTGTCTGACACAGAGTCGGCAGTAAAGTTCTGCGAGATGGTCGGGTACCCCTGCCTGGTTCGGCCCTCCTACGTTCTTAGCGGAGCTGCCATGAACGTGGCGTACAGCGACCGCGACCTGGAGAAATACCTGAGCAGCGCTGTGGCCGTGTCCAAAGAACACCCCGTCGTCATTTCCAAATTCATCCAGGAGGCCAAGGAGATTGACGTAGATGCGATAGCCTGTGACGGCGTAGTGATGGCCATAGCCATTTCTGAGCATGTGGAGAACGCCGGCGTGCACTCGGGTGACGCCACCCTGGTGACGCCAGCACAGGACCTCAATCAGAAGACCATCGAGAGGATCATGGTGATCGTGCATGCCATCGGGCTGGAGCTGCAGGTCACCGGACCCTTCAACCTGCAGCTCATCGCCAAGGATGACCAGCTGAAGGTGATCGAATGTAACGTCAGAGTTTCTCGCTCCTTCCCATTCGTATCCAAGACACTGGGGGTAGACCTGGTTGCCCTGGCAACCCAAACCATCATGGGGGAGGAGGTGGAGCCAGTGGGCCTAATGAAAGGGAAAGGGATCGTGGGAGTAAAGGTTCCCCAGTTCTCCTTCTCTCGGCTGGCCGGGGCAGACGTTGTGCTCGGCGTGGAGATGACCAGCACCGGAGAGGTGGCGTGTTTTGGGGAGAACAGGTACGAAGCTTACCTCAAGGCCATGCTCTCGACCGGCTTCAAAATCCCCAAGAAGAACATCCTGCTGTCCATCGGCAGCTATAAGAACAAGAACGAGCTCCTGTCCACGGTGCAGACTCTGGAGGCGCTGGGATACGACCTGTACGCCAGCCTGGGAACGGCAGACTTCTACACCGGAGTCAAGGTCACCGCAGTGGACTGGCCGTTTGAGGAGGACTGTCCCAAGCAGCGCAGCATCATGAACTACCTGGAGGAGAACCACTTCGACCTGGTCATCAACCTGTCGATGAGGAACAGTGGAGGCCGACGGCTCTCCTCCTTCGTCACCAAAGGCTACAGGACCAGACGCATGGCGGTGGACTTCTCTGTGCCCCTCATCATCGACATCAAATGCACCAAGCTCTTCGTCCAG
a0000 CCACCACGAAAGGTTCTGATTTTAGGCTCTGGGGGCCTCTCCATTGGCCAAGCTGGAGAGTTTGACTACTCAGGCTCTCAGGCAATTAAGGCCCTAAAGGAGGAAAACATCCAGACATTGCTGATCAACCCCAACATTGCCACAGTGCAGACTTCCCAGGGGCTGGCTGACAAAGTCTATTTCCTTCCCATAACACCTCACTATGTAACTCAGGTGATCCGCAATGAGCGCCCAGATGGCATATTACTGACTTTTGGGGGCCAAACAGCTCTGAACTGTGGTGTGGAGCTGACCAAGGCCGGAGTATTAGCGCGGTATGGGGTCCGGGTCCTGGGCACACCTGTGGAAACCATTGAACTGACTGAAGATCGGCGTGCCTTTGCCTCCAGGATGGCAGAGATTGGAGAACATGTGGCCCCCAGTGAGGCGGCTAGTTCTCTTGAACAGGCCCAAGCAGCTGCTGAGCGGCTGGGGTATCCAGTGCTGGTGCGTGCAGCCTTTGCCCTGGGTGGCCTGGGCTCTGGCTTTGCCTCTAACAGGGACGAGCTCTCTGCTCTTGTGGCTCCCGCTTTTGCCCATACCAGCCAGGTGCTGGTAGACAAGTCCCTGAAGGGATGGAAGGAGATTGAATATGAGGTGGTGAGAGATGCCTATGGCAACTGTGTCACGGTGTGTAACATGGAGAATTTGGACCCATTGGGCATCCATACTGGTGAGTCCATAGTGGTGGCTCCAAGCCAGACGCTGAATGACAGGGAATACCAGCTCCTGCGGCAGACAGCCATCAAGGTGACGCAGCACCTTGGAATTGTTGGCGAGTGCAACGTGCAGTATGCATTGAACCCCGAATCCGAGCAGTATTACATTATTGAAGTGAATGCCAGGCTCTCCCGCAGCTCCGCCCTGGCCAGTAAGGCCACAGGTTATCCATATGTGGCAGCCAAACTAGCTCTGGGCATCCCTCTGCCTGAGCTCAGGAACTCCGTGACAGGGGGAACAGCAGCCTTTGAACCCAGCCTGGATTACTGTGTGGTGAAGATCCCTCGCTGGGACCTCAAGTTCCTTCGTGTCAGCACAAAGATCGGGAGCTGCATGAAGAGCGTTGGTGAAGTTATGGGCATTGGGCGTTCTTTTGAGGAGGCCTTCCAGAAGGCTCTTCGCATGGTGGATGAGAACTGTGTGGGCTTTGATCACACAGTAAAGCCGGTCAGTGATATGGAGTTGGAGACACCAACTGATAAGCGGATCTTTGTGGTGGCAGCTGCTCTGTGGGCTGGCTATTCGGTGGAGCGGCTGTACCAACTCACGCGCATCGACCGCTGGTTCCTGCACCGGATGAAGAGGATTATAGCACATGCCCAGCTGCTGGAACAGCATCGTGGACAGCCTTTGCCCCCAGACCTGCTGCACCAGGCCAAGCGCCTTGGCTTCTCAGACAAGCAGATTGCCCTTGCTGTTCTGAGCACAGAGCTGGCTGTTCGCAAGCTGCGTCAGGAACTGGGGATCTGCCCGGCGGTGAAACAGATTGACACAGTTGCAGCTGAGTGGCCAGCCCAGACAAATTATTTGTACCTGACATACTGGGGAACCACGCACGACCTCACCTTTCGAACGCCACACGTCCTGGTCCTTGGCTCTGGCGTCTACCGTATAGGCTCCAGCGTTGAGTTTGACTGGTGTGCTGTGGGCTGCATCCGGCAGCTCCGAAAGATGGGATATAAGACCATCATGGTGAACTACAACCCAGAGACAGTCAGCACTGATTATGACATGTGTGACCGACTCTACTTTGATGAGATCTCTTTTGAGGTGGTGATGGACATCTATGAGCTAGAGAACCCTGAAGGCGTGATCCTGTCCATGGGTGGGCAGCTGCCCAACAACATGGCCATGGCTTTGCATCGGCAGCAGTGCCGGGTGCTGGGCACTTCTCCGGAAGCCATCGACTCAGCTGAGAACCGTTTCAAATTCTCCCGGCTCCTAGATACCATTGGTATCAGCCAGCCTCAGTGGAGGGAGCTCAGTGACCTAGAGTCTGCTCGCCAGTTCTGCCAGACGGTGGGGTACCCCTGCGTTGTGCGCCCCTCCTATGTGCTAAGCGGCGCTGCTATGAATGTGGCCTACACCGATGGGGACCTGGAGCGTTTCCTGAGCAGTGCGGCAGCCGTCTCTAAGGAGCACCCTGTGGTCATCTCTAAGTTCATCCAGGAGGCCAAGGAGATTGACGTGGATGCTGTGGCCCGTGATGGTGTGGTGGCAGCCATTGCCATCTCTGAGCATGTGGAGAATGCAGGTGTACATTCAGGTGATGCCACGCTGGTGACCCCACCTCAAGACATCACTGCCAAAACCCTGGAGCGGATTAAAGCCATCGTGCACGCTGTGGGCCAGGAGCTGCAGGTCACAGGACCCTTCAATCTGCAGCTCATTGCCAAGGATGACCAACTGAAAGTCATCGAATGCAACGTGCGTGTCTCTCGCTCCTTCCCTTTCGTCTCCAAGACACTTGGTGTGGACCTAGTAGCACTGGCCACCCGGGTCATCATGGGGGAAGAAGTGGAACCTGTGGGGCTCATGACTGGCTCCGGAGTCGTGGGGGTGAAGGTCCCTCAGTTCTCGTTTTCCCGTCTGGCGGGTGCTGATGTGGTGTTGGGTGTGGAGATGACCAGTACCGGGGAAGTGGCTGGCTTTGGGGAGAGCCGCTGCGAGGCATACCTCAAGGCCATGCTAAGCACTGGCTTTAAGATCCCCAAGAAGAACATCTTGCTGACCATTGGCAGCTATAAGAACAAAAGTGAGCTGCTCCCAACCGTGCGGCTGCTGGAGAGCCTTGGCTACAGCCTTTACGCCAGTCTGGGCACTGCTGACTTCTATACGGGCGTCAAGGTAACAGCTGTGGACTGGCACTTTGAGGAGGGTTGCCCACCACAGCGAAGCATCTTGGAGCAGCTGGCTGAGAATCACTTTGAACTAGTGATAAACCTATCGATGCGTGGGGCTGGGGGCCGGCGTCTTTCTTCCTTCGTCACCAAGGGCTACCGCACCCGGCGCCTGGCTGCTGACTTCTCCGTGCCCCTCATCATTGATATCAAGTGCACCAAACTGTTTGTGGAG
a0003 CGACCGAGGAAGGTCCTCATCCTGGGCTCCGGAGGGCTATCCATCGGCCAGGCCGGGGAGTTTGACTACTCCGGCTCCCAGGCCATTAAAGCGCTCAAGGAAGAGAACATCCAGACCGTGCTGATCAACCCAAACATCGCCACTGTCCAGACCTCCAAGGGCTTGGCTGACAAAGTCTACTTCCTGCCTATCACGGCGGAGTATGTCACTCAGGTGATCAAAAATGAACGTCCAGACGGCGTGCTGCTGACCTTCGGCGGTCAGACGGCGTTGAACTGCGGCGTGGAGCTCACCAAGCTGGGCGTCCTGGAGAAGTACGAAGTTAAGGTTTTGGGGACACCCGTGGCGTCCATCGAGATGACCGAAGACCGGAAAGTCTTTGTGGAGAAGATGGAAGAGATCAACGAACACGTCGCACCCAGCGAAGCGGCGCTTTCTGTCGATCAGGCGGTGGCAGCTGCCGAACGCCTCGGCTACCCGGTTCTGGTGCGCGCGGCGTTTTCGCTGGGAGGCCTGGGCTCGGGCTTCGCCAACAACGGGGAGGAGCTCGTCGCTCTGGTGACCGCAGCCTTCGCCCACACTTCCCAGGTGCTCGTGGACAAATCCCTGAAGGGCTGGAAGGAGATTGAGTACGAGGTGGTTCGCGATGCCTACGACAACTGTGTGACGGTGTGTAATATGGAGAATATTGACCCTCTGGGCATCCATACTGGAGAATCCATCGTTGTGGCGCCCAGTCAGACGCTCAACGACCACGAGTACAACATGCTGAGGAACACTGCTATCAAAGTCATCAGGCACCTCGGCATCGTAGGAGAGTGCAACATCCAGTACGCCCTTAACCCAGAATCTGAACAGTACTACATCATCGAGGTGAATGCCCGTCTGTCACGGAGCTCGGCCCTGGCCAGTAAGGCGACCGGTTATCCTTATGTTGCAGCCAAACTGGGCCTGGGGATCCCACTGCCACTACTCAAGAACTCTGTGACCAACTCGACAACAGCGTTTGAGCCCAGCTTGGACTACTGCGTGGTGAAGGTGCCTCGCTGGGATCTCAAGTTCCTCAGGGTTTCCACTGAGATTGGCAGCTCCATGAAGAGTGTTGGCGAGGTAATGGCCATCGGCCGCAACTTTGAAGAGGCCTTCCAGAAAGCTCTGAGGATGGTGGACGAGAACTGTGTCGGCTTTGACCACACCATCAAGCCCGTCTCTGAGAAGGAGTTGCAGATTCCTACGGACAAGCGCATCTTTGTTTTGGCGTCGGCCTTTCGAGCCGGCTACACGGTGGACCAGCTGAATGAGCTCACCAAGATCGACCGCTGGTTCCTGCACAAGATGAAGAACATCGCCGACCACGAGCAATTGTTGGAGACGTACAACCAGGATGCCATGCCTCCAGAGGTGTTGCGAAAGGCCAAACAGCTGGGCTTTTCAGACAAGCAGATCGCCCAAGCTGTACAGAGCACAGAACTTGTCGTTCGAAAGCTGCGTCACGATTGGTCCATCCTCCCTGTAGTGAAGCAGATTGACACAGTGGCGGCCGAATGGCCCGCCCACACGAACTACCTGTACCTGACCTACCACGGCACAGAGGACGACCTGGCCTTCAACGACCAGCACATCATGGTGATCGGCTCGGGCGTTTACCGCATCGGCAGCAGCGTGGAGTTCGACTGGTGCGCGGTCGGGTGCATCACAGAGCTCAGGAAGATGGGCTATAAGACCATCATGGTGAACTACAACCCAGAGACCGTCAGTACAGACTATGACATGTGTGACCGCCTCTACTTTGACGAGATTTCCTTTGAGGTGGTGATGGATATCTATGAGAGGGAAAACCCCGAGGGAGTGATCCTGTCCATGGGCGGCCAGCTTCCCAACAACATCGCCATGTCGCTGCACCGTCAGCAGTGCCGCATCCTGGGAACCTCCCCCGAGTTCATCGACTCGGCCGAGAACAGGTTCAAGTTCTCCCGAATGCTGGACACCATCGGAATCAGCCAGCCGCAGTGGAAGGAGCTCTCCGACAGGAAGTCTGCTGTGACGTTTTGTGAGACCGTGGGTTATCCCTGCCTGGTTCGTCCTTCCTACGTTCTCAGCGGGGCGGCCATGAACGTCGCCTATAGCGACAGCGACCTCGAGAAATACCTCACCGACGCTGTCGCCGTGTCCAAGGAATATCCCGTCGTGATCTCCAAATTCATCCAGGAGGCCAAGGAGATAGACGTGGACGCCGTCGCCTCTGATGGGGTGGTGATGGCCATCGCGGTGTCTGAACACGTGGAGAACGCCGGCGTCCACTCTGGAGATGCCACACTGGTGACGCCCCCGCAGGACCTCAATCAGAAGACGATGGAGAGGATCCAGGTGATCGTCCATGCCATCGCTCAGGAGCTGCAGGTCACTGGACCTTTCAACTTGCAGCTGATCGCCAAGGATGACCAACTGAAAGTGATCGAGTGCAACGTCAGAGTCTCCCGCTCCTTCCCCTTTATATCAAAGACACTGGGCGTGGACCTGGTCGCGTTGGCAACACAGATCATTGTGGGGGAAGACGTGGAGCCCTTGGGCCTCATGAGAGGCAAAGGGATTGTGGGAGTGAAGGTCCCCCAATTTTCGTTCTCTCGCCTGGCCGGAGCCGACGTGGTGCTCGGGGTGGAGATGACCAGCACTGGCGAGGTGGCGTGTTTTGGGGAGAACCGATACGAGGCTTACCTCAAAGCCATGCTCTCCACGGGCTTTAAGATCCCCAAAAAGAACATCCTGCTGTCCATCGGCAGTTATAAGAACAAGAGTGAGCTGCTGCCCACCGTGCAGGCTCTGGAGTCCATGGGTTACGACCTGTACGCCAGTCTGGGTACTGCAGACTTCTACACAGGAGTCAAGGTGAAAGCAGTGGACTGGCCATTTGAGGAGAGCTGTCCCAAGCAGCGCAGCATCATGAACTACTTGGAGGAAAACCACTTTGATCTGGTCATCAACCTTTCCATGAGGAACAGTGGAGGTCGCCGGCTCTCCTCCTTCGTCACCAAGGGCTACAGGACAAGACGCATGGCCATCGACTACTCCGTCCCGCTCATCATCGACATCAAGTGCACCAAGCTCTTTGTCCAG
a0013 CGACCCAAAAAGGTCTTAATCCTGGGCTCAGGAGGCCTGTCCATTGGCCAGGCCGGGGAATTTGACTACTCTGGCTCTCAGGCTATTAAAGCTCTCAAGGAGGAGAACATCCAGACAGTGCTGATCAACCCCAACATCGCAACTGTCCAGACTTCTAAGGGGCTGGCTGACAAAGTCTATTTCCTGCCTATCACACCAGAGTATGTCACCCAGGTGATAAAGAATGAGCGACCTGACGGTGTGTTGCTGACCTTCGGTGGTCAGACGGCCTTGAACTGCGGGGTGGAGCTCACCAAGCAGGGGATCCTGGAGAAGTATAAAGTCACGGTTCTGGGGACGCCAGTGGCCTCCATTGAGATGACCGAAGACAGGAAAATCTTTGTGGAGAAAATGGAAGAGATCAACGAACATGTGGCTCCCAGTGAAGCAGCACTGTCTGTGGAGCAGGCTGTCTCTGCCGCAGAACGTCTGGGCTACCCTGTTCTGGTCCGTTCAGCATTCGCTCTTGGAGGACTGGGTTCAGGCTTCGCCAACAACAGTGAGGAGCTTGTCACTTTGGTGACGTCAGCGTTTGCACACACATCACAGGTCCTGGTGGACAAATCACTCAAAGGCTGGAAGGAGATCGAGTATGAGGTTGTTCGAGATGCCTACGACAACTGCGTCACCGTGTGTAACATGGAGAACATCGACCCTCTGGGAATCCATACGGGAGAATCCATTGTGGTGGCGCCGAGTCAAACGCTCAATGACTATGAATATAACATGCTGAGGAACACGGCCATCAAAGTCATTAGACACCTCGGCATTGTTGGGGAGTGTAACATCCAATATGCTCTGAACCCAGAGTCTGAGCAGTACTACATCATTGAGGTGAATGCTCGCCTATCGCGTAGCTCGGCCCTGGCGAGCAAGGCCACGGGTTATCCTTATGTCGCAGCTAAACTGGGTCTGGGCATCCCACTGCCCCAGCTGAAGAACTCTGTGACCAACTCGACAACAGCCTTTGAGCCGAGTTTGGACTACTGTGTGGTGAAGGTGCCTCGCTGGGATCTCAAGTTCCTCAGGGTTTCCACCAAGATAGGCAGCTCCATGAAGAGTGTTGGTGAGGTGATGGCTATCGGCCGAAGCTTTGAGGAGGCCTTCCAGAAAGCTCTGAGGATGGTGGATGAGAACTGTGTCGGCTTCGATCACACCATCAAACCTGTTTCTGAAAAGGAGTTGCAGACGCCAACAGATAAGCGCATCTTTGTCCTGGCTGCAGCCTTCAGAGCTGGTTACACCGTGGACCAGCTGTACGAGCTAACTAAGATTGACCGCTGGTTCCTGCACAAGATGAAGAACATCACCGACCACGAGCGCTTGCTGGAGACTTACAACCAGGACGCCATGCCTGCAGAGGTGATACTCAAAGCCAAGCAGCTCGGCTTCTCGGACAAGCAGATAGCGCTCGCTGTGCAGAGCACTGAGCTTGTGGTGAGAAAGCTGCGTCATGAACGGTCCATCCTGCCCGTGGTGAAGCAGATCGACACGGTGGCCGCCGAGTGGCCTGCCTTCACCAACTACCTGTACCTGACATACCACGGTACAGAGAACGACCTGCATTTCAACGACCAGCACGTGATGGTGATCGGCTCAGGCGTCTACCGCATCGGCAGCAGCGTGGAGTTTGACTGGTGCGCAGTTGGATGCATCACTGAACTCAGGAAGATGGGCTATAAGACCATCATGGTGAACTATAACCCAGAAACTGTCAGTACAGACTACGACATGTGTGACCGTCTCTACTTTGACGAAATCTCCTTTGAGGTGGTGATGGATATCTACGAGAGGGAGAATCCAGATGGAATAATCCTCTCTATGGGAGGCCAGCTGCCCAACAACATAGCCATGTCTCTGCACCGCCAGCAGTGCCGCATCCTGGGAACCTCGCCAGAGTTCATAGACAGTGCTGAGAACAGGTTTAAGTTCTCCCGCATGCTCGACACCATCGGGATCAGCCAACCACAGTGGAAGGAGCTCTCCGACACTGAATCTGCCATGAAGTTTTGTGAGACTGTGGGTTATCCATGCCTGGTCCGGCCCTCCTACGTTCTCAGTGGTGCAGCCATGAACGTTGCCTACGGTGACAGTGACCTGGAAAAGTACCTGAGCAGCGCTGTGGCCGTGTCCAAAGAACACCCGGTCGTCATCTCGAAATTCATACAGGAGGCCAAGGAGATCGATGTAGATGCCGTAGCCTGCGACGGGGTGGTGATGGCCATCGCGATATCGGAGCATGTGGAGAATGCCGGCGTTCACTCGGGAGACGCCACTTTGGTGACGCCACCTCAGGACCTCAACCAGAAGACGATGGAGACGATCAAGATGATCGTCCACGCCATTGGTCAAGAGCTGCAGGTTACCGGACCGTTTAACCTGCAGCTGATTGCAAAGGACGACCAGCTGAAGGTGATCGAGTGCAATGTTCGAGTCTCTCGCTCCTTCCCCTTCGTATCAAAGACCCTGGGTGTGGACCTGGTAGCTATGGCTACTCAGGCCATTATGGGGGAGGATGTTGAGCCCCTGGGCCTCATGGCAGGAAAGGGGATTGTTGGAGTCAAGGTTCCCCAGTTCTCCTTCTCTAGATTGGCTGGTGCTGACGTGGTGCTTGGTGTAGAGATGACCAGCACTGGGGAGGTGGCCTGCTTTGGGGAGAACAGATATGAGGCATATCTGAAAGCCATGCTCTCTACAGGCTTCAAGATCCCCAAAAAGAACATCCTGCTCTCCATTGGTAGCTATAAGAACAAAAGTGAGCTGCTGCCCACCGTTCAGGCCCTGGAGTCTCTGGGTTATGACCTGTACGCCAGTCTGGGAACTGCAGATTTCTACACGGGCGTCAAAGTATCCCCAGTCGATTGGCCGTTTGAGGAGGGGTGTCCGAAGCAACGCAGCATCATGAACTATCTGGAAGAGAATCACTTTGATCTGGTCATCAACCTGTCCATGAGGAACAGCGGAGGTCGGAGGCTCTCCTCGTTCGTCACCAAAGGTTACAGGACGAGGCGCATGGCGGTGGACTACTCTGTCCCGCTCATCATTGATATTAAATGCACCAAGCTCTTTGTTCAG
CODONML (in paml version 4.8a, July 2014) ./bad_cases/HBG010916-1.phy
Model: several dN/dS ratios for branches for branches, omega = 1.000 fixed
Codon frequency model: F3x4
Site-class models: PositiveSelection
ns = 14 ls = 1038
Codon usage in sequences
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 34 22 18 11 16 21 | Ser TCT 13 19 16 5 19 16 | Tyr TAT 20 20 22 4 11 21 | Cys TGT 12 11 9 2 10 8
TTC 16 15 20 29 19 18 | TCC 17 15 15 29 22 20 | TAC 13 14 17 30 22 19 | TGC 9 8 8 15 9 13
Leu TTA 10 1 1 0 2 2 | TCA 10 6 11 6 10 7 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 13 13 17 5 15 15 | TCG 3 2 4 7 1 7 | TAG 0 0 0 0 0 0 | Trp TGG 13 9 8 7 9 8
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 12 7 13 4 8 7 | Pro CCT 12 14 13 6 12 6 | His CAT 12 11 8 1 9 10 | Arg CGT 9 11 6 4 10 7
CTC 22 21 15 20 22 17 | CCC 13 13 8 25 16 20 | CAC 8 6 9 16 9 9 | CGC 14 15 11 32 20 16
CTA 13 15 2 1 11 7 | CCA 19 16 15 1 15 7 | Gln CAA 5 6 10 0 5 3 | CGA 7 9 6 2 5 7
CTG 42 49 38 67 47 53 | CCG 1 2 5 11 3 8 | CAG 39 38 28 38 39 39 | CGG 13 13 4 13 13 6
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 21 22 25 8 20 24 | Thr ACT 12 10 19 5 10 14 | Asn AAT 15 11 15 4 7 15 | Ser AGT 8 4 13 2 9 13
ATC 32 31 31 54 33 30 | ACC 21 22 14 29 23 20 | AAC 16 20 29 35 23 26 | AGC 19 23 13 22 15 12
ATA 12 3 9 0 3 8 | ACA 22 21 18 6 18 11 | Lys AAA 19 10 28 3 7 16 | Arg AGA 4 2 12 1 3 2
Met ATG 26 20 34 24 21 29 | ACG 3 6 5 18 7 11 | AAG 33 36 35 51 38 34 | AGG 4 6 7 2 7 5
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 13 9 29 4 7 18 | Ala GCT 22 26 27 12 28 20 | Asp GAT 18 16 22 8 16 19 | Gly GGT 18 20 18 12 15 10
GTC 18 19 18 23 24 22 | GCC 32 46 30 47 41 42 | GAC 26 28 26 37 28 25 | GGC 28 30 14 42 30 26
GTA 12 7 8 2 8 14 | GCA 16 19 13 8 16 11 | Glu GAA 17 18 26 2 21 14 | GGA 12 12 25 4 11 17
GTG 52 65 48 71 62 53 | GCG 3 3 6 22 6 6 | GAG 45 55 54 69 51 56 | GGG 15 17 10 16 21 18
--------------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------------
Phe TTT 12 20 16 15 9 20 | Ser TCT 8 15 18 14 11 16 | Tyr TAT 5 22 13 13 2 18 | Cys TGT 5 12 4 7 10 7
TTC 24 17 21 22 28 17 | TCC 29 18 16 19 28 19 | TAC 31 12 21 21 36 16 | TGC 14 8 17 14 9 11
Leu TTA 3 2 5 5 0 3 | TCA 4 6 6 5 2 4 | *** TAA 0 0 0 0 0 0 | *** TGA 0 0 0 0 0 0
TTG 8 17 9 10 6 11 | TCG 10 2 2 5 8 3 | TAG 0 0 0 0 0 0 | Trp TGG 6 8 9 9 8 9
--------------------------------------------------------------------------------------------------------------------------------------
Leu CTT 5 11 9 9 4 13 | Pro CCT 11 20 7 9 8 13 | His CAT 6 7 8 7 4 8 | Arg CGT 4 8 11 9 4 14
CTC 17 17 23 22 21 17 | CCC 13 11 18 16 19 13 | CAC 15 13 12 12 12 11 | CGC 15 14 10 12 12 15
CTA 1 12 11 6 1 10 | CCA 6 11 15 17 5 16 | Gln CAA 4 12 8 7 1 6 | CGA 5 16 12 7 3 5
CTG 61 47 51 55 62 53 | CCG 13 2 3 2 7 3 | CAG 35 28 34 34 38 37 | CGG 8 10 16 22 11 17
--------------------------------------------------------------------------------------------------------------------------------------
Ile ATT 3 24 25 25 5 21 | Thr ACT 7 24 13 10 3 12 | Asn AAT 1 13 10 10 2 9 | Ser AGT 6 15 11 10 3 9
ATC 55 26 30 30 54 30 | ACC 26 12 19 23 34 18 | AAC 42 17 21 21 42 21 | AGC 20 13 16 17 19 19
ATA 2 6 3 4 5 6 | ACA 7 20 19 19 4 20 | Lys AAA 20 10 10 11 20 9 | Arg AGA 2 3 3 4 4 1
Met ATG 29 22 20 19 30 20 | ACG 14 3 7 7 19 9 | AAG 40 35 36 37 42 36 | AGG 13 7 3 2 10 7
--------------------------------------------------------------------------------------------------------------------------------------
Val GTT 11 16 10 11 12 9 | Ala GCT 26 35 30 34 12 34 | Asp GAT 11 22 13 14 10 18 | Gly GGT 11 20 23 18 14 14
GTC 29 21 20 20 28 21 | GCC 37 29 44 41 41 39 | GAC 39 23 32 31 42 26 | GGC 32 25 29 31 25 35
GTA 6 20 18 15 6 7 | GCA 4 26 14 14 7 15 | Glu GAA 7 29 19 17 7 22 | GGA 17 16 10 9 14 11
GTG 56 41 49 52 56 61 | GCG 12 3 5 1 18 5 | GAG 63 45 54 55 65 50 | GGG 12 19 17 21 16 19
--------------------------------------------------------------------------------------------------------------------------------------
----------------------------------------------------------------------
Phe TTT 19 16 | Ser TCT 9 16 | Tyr TAT 10 17 | Cys TGT 7 7
TTC 18 22 | TCC 29 17 | TAC 29 23 | TGC 9 10
Leu TTA 0 1 | TCA 3 8 | *** TAA 0 0 | *** TGA 0 0
TTG 13 8 | TCG 9 9 | TAG 0 0 | Trp TGG 8 7
----------------------------------------------------------------------
Leu CTT 5 4 | Pro CCT 9 10 | His CAT 2 5 | Arg CGT 5 5
CTC 27 23 | CCC 18 12 | CAC 15 12 | CGC 15 12
CTA 2 2 | CCA 8 12 | Gln CAA 4 5 | CGA 6 5
CTG 47 55 | CCG 5 7 | CAG 36 34 | CGG 3 3
----------------------------------------------------------------------
Ile ATT 9 15 | Thr ACT 9 14 | Asn AAT 6 7 | Ser AGT 8 11
ATC 55 42 | ACC 21 20 | AAC 38 36 | AGC 14 14
ATA 2 9 | ACA 13 10 | Lys AAA 16 21 | Arg AGA 3 5
Met ATG 27 30 | ACG 12 15 | AAG 44 41 | AGG 12 11
----------------------------------------------------------------------
Val GTT 13 19 | Ala GCT 11 20 | Asp GAT 10 14 | Gly GGT 6 20
GTC 31 27 | GCC 42 34 | GAC 43 36 | GGC 37 22
GTA 4 6 | GCA 7 15 | Glu GAA 19 17 | GGA 13 15
GTG 55 47 | GCG 19 6 | GAG 57 59 | GGG 12 13
----------------------------------------------------------------------
Codon position x base (3x4) table for each sequence.
#1: a0010
position 1: T:0.17630 C:0.23218 A:0.25723 G:0.33430
position 2: T:0.33526 C:0.21098 A:0.27553 G:0.17823
position 3: T:0.24181 C:0.29287 A:0.17148 G:0.29383
Average T:0.25112 C:0.24534 A:0.23475 G:0.26879
#2: a0006
position 1: T:0.14933 C:0.23699 A:0.23796 G:0.37572
position 2: T:0.30732 C:0.23121 A:0.27842 G:0.18304
position 3: T:0.22447 C:0.31407 A:0.13969 G:0.32177
Average T:0.22704 C:0.26076 A:0.21869 G:0.29351
#3: a0004
position 1: T:0.15992 C:0.18401 A:0.29576 G:0.36031
position 2: T:0.31407 C:0.21098 A:0.31696 G:0.15800
position 3: T:0.26301 C:0.26782 A:0.17726 G:0.29191
Average T:0.24566 C:0.22094 A:0.26333 G:0.27007
#4: a0008
position 1: T:0.14507 C:0.23308 A:0.25532 G:0.36654
position 2: T:0.31238 C:0.22921 A:0.28820 G:0.17021
position 3: T:0.08897 C:0.46905 A:0.03482 G:0.40716
Average T:0.18214 C:0.31044 A:0.19278 G:0.31464
#5: a0012
position 1: T:0.15896 C:0.23507 A:0.23507 G:0.37091
position 2: T:0.30636 C:0.23796 A:0.27553 G:0.18015
position 3: T:0.19942 C:0.34297 A:0.13006 G:0.32755
Average T:0.22158 C:0.27200 A:0.21355 G:0.29287
#6: a0011
position 1: T:0.16859 C:0.21387 A:0.26012 G:0.35742
position 2: T:0.32563 C:0.21773 A:0.29480 G:0.16185
position 3: T:0.22062 C:0.32274 A:0.12139 G:0.33526
Average T:0.23828 C:0.25145 A:0.22543 G:0.28484
#7: a0002
position 1: T:0.15318 C:0.21098 A:0.27649 G:0.35934
position 2: T:0.31021 C:0.21869 A:0.30732 G:0.16378
position 3: T:0.12717 C:0.42197 A:0.08478 G:0.36609
Average T:0.19685 C:0.28388 A:0.22286 G:0.29640
#8: a0009
position 1: T:0.15318 C:0.23025 A:0.24085 G:0.37572
position 2: T:0.30732 C:0.22832 A:0.27746 G:0.18690
position 3: T:0.27360 C:0.26590 A:0.18208 G:0.27842
Average T:0.24470 C:0.24149 A:0.23346 G:0.28035
#9: a0005
position 1: T:0.15125 C:0.23892 A:0.23699 G:0.37283
position 2: T:0.30829 C:0.22736 A:0.28035 G:0.18401
position 3: T:0.21291 C:0.33622 A:0.14740 G:0.30347
Average T:0.22415 C:0.26750 A:0.22158 G:0.28677
#10: a0001
position 1: T:0.15318 C:0.23699 A:0.23988 G:0.36994
position 2: T:0.30829 C:0.22736 A:0.27938 G:0.18497
position 3: T:0.20713 C:0.33911 A:0.13487 G:0.31888
Average T:0.22286 C:0.26782 A:0.21805 G:0.29127
#11: a0007
position 1: T:0.15125 C:0.20424 A:0.28516 G:0.35934
position 2: T:0.31503 C:0.21773 A:0.31118 G:0.15607
position 3: T:0.10886 C:0.43353 A:0.07611 G:0.38150
Average T:0.19171 C:0.28516 A:0.22415 G:0.29897
#12: a0000
position 1: T:0.14836 C:0.24181 A:0.23796 G:0.37187
position 2: T:0.30732 C:0.23025 A:0.27649 G:0.18593
position 3: T:0.22640 C:0.31599 A:0.13006 G:0.32755
Average T:0.22736 C:0.26268 A:0.21484 G:0.29512
#13: a0003
position 1: T:0.15703 C:0.19942 A:0.27842 G:0.36513
position 2: T:0.31503 C:0.21580 A:0.31696 G:0.15222
position 3: T:0.13295 C:0.42486 A:0.09634 G:0.34586
Average T:0.20167 C:0.28003 A:0.23057 G:0.28773
#14: a0013
position 1: T:0.15511 C:0.19846 A:0.28998 G:0.35645
position 2: T:0.31407 C:0.21676 A:0.31503 G:0.15414
position 3: T:0.19268 C:0.34875 A:0.12620 G:0.33237
Average T:0.22062 C:0.25466 A:0.24374 G:0.28099
Sums of codon usage counts
------------------------------------------------------------------------------
Phe F TTT 249 | Ser S TCT 195 | Tyr Y TAT 198 | Cys C TGT 111
TTC 286 | TCC 293 | TAC 304 | TGC 154
Leu L TTA 35 | TCA 88 | *** * TAA 0 | *** * TGA 0
TTG 160 | TCG 72 | TAG 0 | Trp W TGG 118
------------------------------------------------------------------------------
Leu L CTT 111 | Pro P CCT 150 | His H CAT 98 | Arg R CGT 107
CTC 284 | CCC 215 | CAC 159 | CGC 213
CTA 94 | CCA 163 | Gln Q CAA 76 | CGA 95
CTG 727 | CCG 72 | CAG 497 | CGG 152
------------------------------------------------------------------------------
Ile I ATT 247 | Thr T ACT 162 | Asn N AAT 125 | Ser S AGT 122
ATC 533 | ACC 302 | AAC 387 | AGC 236
ATA 72 | ACA 208 | Lys K AAA 200 | Arg R AGA 49
Met M ATG 351 | ACG 136 | AAG 538 | AGG 96
------------------------------------------------------------------------------
Val V GTT 181 | Ala A GCT 337 | Asp D GAT 211 | Gly G GGT 219
GTC 321 | GCC 545 | GAC 442 | GGC 406
GTA 133 | GCA 185 | Glu E GAA 235 | GGA 186
GTG 768 | GCG 115 | GAG 778 | GGG 226
------------------------------------------------------------------------------
(Ambiguity data are not used in the counts.)
Codon position x base (3x4) table, overall
position 1: T:0.15577 C:0.22116 A:0.25909 G:0.36399
position 2: T:0.31333 C:0.22288 A:0.29240 G:0.17139
position 3: T:0.19431 C:0.34967 A:0.12521 G:0.33081
Average T:0.22114 C:0.26457 A:0.22556 G:0.28873
Nei & Gojobori 1986. dN/dS (dN, dS)
(Pairwise deletion)
(Note: This matrix is not used in later ML. analysis.
Use runmode = -2 for ML pairwise comparison.)
a0010
a0006 0.5463 (0.1461 0.2674)
a0004 0.1023 (0.2590 2.5320) 0.0593 (0.1205 2.0328)
a0008 0.1486 (0.2298 1.5464) 0.0765 (0.0884 1.1548) 0.0427 (0.0880 2.0622)
a0012 0.2550 (0.1756 0.6884) 0.0529 (0.0250 0.4720) 0.0653 (0.1436 2.1991) 0.0983 (0.1114 1.1336)
a0011 0.1541 (0.2982 1.9356) 0.0865 (0.1468 1.6977) 0.0608 (0.1349 2.2175) 0.0903 (0.1120 1.2412) 0.0979 (0.1708 1.7453)
a0002 0.1358 (0.2905 2.1391) 0.0885 (0.1452 1.6418) 0.0465 (0.0889 1.9101) 0.1353 (0.1196 0.8841) 0.1061 (0.1680 1.5843) 0.0983 (0.1640 1.6677)
a0009 0.1350 (0.1659 1.2292) 0.0201 (0.0208 1.0320) 0.0588 (0.1206 2.0516) 0.0472 (0.0915 1.9382) 0.0319 (0.0416 1.3058) 0.0703 (0.1405 1.9997)-1.0000 (0.1375 -1.0000)
a0005 0.2387 (0.1569 0.6572) 0.0252 (0.0135 0.5342) 0.0637 (0.1243 1.9514) 0.0765 (0.0922 1.2053) 0.0486 (0.0343 0.7052) 0.0670 (0.1437 2.1447) 0.0902 (0.1463 1.6214) 0.0177 (0.0241 1.3586)
a0001 0.2292 (0.1566 0.6834) 0.0268 (0.0141 0.5274) 0.0642 (0.1245 1.9408) 0.0848 (0.0958 1.1298) 0.0517 (0.0344 0.6657) 0.0748 (0.1461 1.9522) 0.0977 (0.1459 1.4936) 0.0193 (0.0254 1.3190) 0.0247 (0.0050 0.2013)
a0007 0.1406 (0.2647 1.8828) 0.0732 (0.1198 1.6373) 0.0319 (0.0570 1.7889) 0.1125 (0.0915 0.8137) 0.1015 (0.1407 1.3860) 0.0934 (0.1346 1.4423) 0.0799 (0.0635 0.7950) 0.0352 (0.1193 3.3922) 0.0742 (0.1208 1.6283) 0.0790 (0.1227 1.5536)
a0000 0.2668 (0.1515 0.5676) 0.0170 (0.0067 0.3944) 0.0621 (0.1212 1.9519) 0.0796 (0.0886 1.1124) 0.0583 (0.0275 0.4727) 0.0848 (0.1445 1.7040) 0.0881 (0.1423 1.6154) 0.0179 (0.0213 1.1933) 0.0259 (0.0146 0.5620) 0.0245 (0.0135 0.5496) 0.0807 (0.1174 1.4549)
a0003 0.1382 (0.2642 1.9113) 0.0795 (0.1218 1.5321) 0.0300 (0.0603 2.0140) 0.0958 (0.0932 0.9735) 0.0980 (0.1447 1.4763) 0.0872 (0.1394 1.5988) 0.0768 (0.0638 0.8307) 0.0554 (0.1222 2.2038) 0.0791 (0.1241 1.5693) 0.0807 (0.1266 1.5683) 0.0501 (0.0396 0.7911) 0.0822 (0.1225 1.4907)
a0013 0.1294 (0.2690 2.0790) 0.0719 (0.1242 1.7271) 0.0338 (0.0597 1.7675) 0.0706 (0.0930 1.3176) 0.0852 (0.1448 1.6992) 0.0723 (0.1362 1.8829) 0.0785 (0.0430 0.5483) 0.0453 (0.1182 2.6118) 0.0713 (0.1259 1.7655) 0.0775 (0.1282 1.6543) 0.0344 (0.0340 0.9889) 0.0703 (0.1229 1.7491) 0.0384 (0.0326 0.8489)
NOTE: -1 means that NG86 is inapplicable.
TREE # 1: (((((((10, 9), (1, 2)), (12, 5)), 8), 4), 6), ((11, (13, (14, 7))), 3)); MP score: -1
This is a rooted tree. Please check!
lnL(ntime: 0 np: 4): -21453.788139 +0.000000
2.192281 0.947748 0.033195 0.048787
tree length = 7.47378
(((((((10: 0.075468, 9: 0.085411): 0.207804, (1: 0.720769, 2: 0.020905): 0.105001): 0.012384, (12: 0.142497, 5: 0.282057): 0.018899): 0.178792, 8: 0.443433): 0.714179, 4: 0.474661): 0.143467, 6: 1.098262): 0.162709, ((11: 0.348344, (13: 0.324275, (14: 0.175180, 7: 0.376901): 0.198321): 0.112915): 0.242393, 3: 0.617143): 0.191610);
(((((((a0001: 0.075468, a0005: 0.085411): 0.207804, (a0010: 0.720769, a0006: 0.020905): 0.105001): 0.012384, (a0000: 0.142497, a0012: 0.282057): 0.018899): 0.178792, a0009: 0.443433): 0.714179, a0008: 0.474661): 0.143467, a0011: 1.098262): 0.162709, ((a0007: 0.348344, (a0003: 0.324275, (a0013: 0.175180, a0002: 0.376901): 0.198321): 0.112915): 0.242393, a0004: 0.617143): 0.191610);
Detailed output identifying parameters
kappa (ts/tv) = 2.19228
dN/dS (w) for site classes (K=4)
site class 0 1 2a 2b
proportion 0.94775 0.03319 0.01841 0.00064
background w 0.04879 1.00000 0.04879 1.00000
foreground w 0.04879 1.00000 1.00000 1.00000
Time used: 3:17
Branch: 0
LnL0: -21454.596448777185287
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9369543 p1: 0.0331178 p2a: 0.0289061 p2b: 0.0010217
w0: 0.0486143 k: 2.1933231
LnL1: -21448.333817952348909
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9483211 p1: 0.0321129 p2a: 0.0189251 p2b: 0.0006409
w0: 0.0492891 k: 2.1905633 w2: 13.6167475
Branch: 1
LnL0: NA
LnL1: -21459.483770012466266
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9652215 p1: 0.0347785 p2a: 0.0000000 p2b: 0.0000000
w0: 0.0494665 k: 2.1941787 w2: 1.0000114
Branch: 3
LnL0: NA
LnL1: -21459.483807704789797
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9652215 p1: 0.0347785 p2a: 0.0000000 p2b: 0.0000000
w0: 0.0494666 k: 2.1941760 w2: 1.0000000
Branch: 5
LnL0: NA
LnL1: -21458.908805127593951
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9644126 p1: 0.0339609 p2a: 0.0015711 p2b: 0.0000553
w0: 0.0494235 k: 2.1946897 w2: 11.6775220
Branch: 9
LnL0: -21457.111229530717537
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9399200 p1: 0.0326504 p2a: 0.0265088 p2b: 0.0009208
w0: 0.0490521 k: 2.1924628
LnL1: -21445.893962389753142
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9548026 p1: 0.0301636 p2a: 0.0145734 p2b: 0.0004604
w0: 0.0494380 k: 2.1856173 w2: 125.2127438
Branch: 10
LnL0: -21435.933985360690713
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9160084 p1: 0.0297738 p2a: 0.0525110 p2b: 0.0017068
w0: 0.0473090 k: 2.1875866
LnL1: -21418.499420079388074
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9343024 p1: 0.0289935 p2a: 0.0355994 p2b: 0.0011047
w0: 0.0486971 k: 2.1906125 w2: 8.9675850
Branch: 11
LnL0: NA
LnL1: -21459.483809842404298
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9652215 p1: 0.0347785 p2a: 0.0000000 p2b: 0.0000000
w0: 0.0494665 k: 2.1941795 w2: 1.0000000
Branch: 12
LnL0: NA
LnL1: -21459.483809838111483
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9652213 p1: 0.0347785 p2a: 0.0000002 p2b: 0.0000000
w0: 0.0494665 k: 2.1941719 w2: 1.0000000
Branch: 13
LnL0: NA
LnL1: -21459.483808344582940
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9652215 p1: 0.0347785 p2a: 0.0000000 p2b: 0.0000000
w0: 0.0494665 k: 2.1941765 w2: 1.0000000
Branch: 16
LnL0: NA
LnL1: -21459.483808017190313
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990 0.1424970 0.2820570 0.4434330 0.4746610
1.0982620
p0: 0.9652215 p1: 0.0347785 p2a: 0.0000000 p2b: 0.0000000
w0: 0.0494665 k: 2.1941809 w2: 1.0000000
Branch: 19
LnL0: NA
LnL1: -21459.483811155212607
Branch lengths: 0.3543190 0.2423930 0.3483440 0.1129150 0.3242750 0.1983210 0.1751800 0.3769010
0.6171430 0.1434670 0.7141790 0.1787920 0.0123840 0.2078040 0.0754680 0.0854110
0.1050010 0.7207690 0.0209050 0.0188990