Commit 0129f5b0 authored by Thomas Junier's avatar Thomas Junier
Browse files

formatted code

parent f3c9656b
......@@ -26,7 +26,7 @@ describe FastaReader do
records[1][:seq].should eq "cgatcgacgatcgatgcacgatgaacctacgagcartcgagcatcagagcagcatcgagcagctacgagatt"
end
it "has the right header for record 3" do
records[2][:hdr].should eq "XPQ_LATCH|Latimeria chalumnae unknown protein"
records[2][:hdr].should eq "XPQ_LATCH|Latimeria chalumnae unknown protein"
end
it "has the right sequence for record 3" do
records[2][:seq].should eq "MERTHSNSGDKTSTVSLDVLSRHSHSSVNSTSDHTSASKRSVHDRFHSTCSCM"
......
......@@ -43,5 +43,4 @@ module FastaReader
end
end
end
end
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment